Smartscribe reverse transcriptase

Manufactured by Takara Bio

Sourced in United States, Japan

SMARTScribe Reverse Transcriptase is a recombinant reverse transcriptase enzyme used for the conversion of RNA into cDNA. It has high thermal stability and can efficiently transcribe long and GC-rich templates.

Automatically generated - may contain errors

Lab products found in correlation

Ampure xp bead, by Beckman Coulter (9 mentions) Trizol reagent, by Thermo Fisher Scientific (9 mentions) Trizol, by Thermo Fisher Scientific (8 mentions) Random hexamer primer, by Thermo Fisher Scientific (6 mentions) Rneasy mini kit, by Qiagen (6 mentions) Dntps, by Thermo Fisher Scientific (4 mentions) Seqamp polymerase, by Takara Bio (3 mentions) Lambda exonuclease, by New England Biolabs (3 mentions) Rnase a, by Thermo Fisher Scientific (3 mentions) Hiseq 2500 platform, by Illumina (3 mentions) Rneasy micro kit, by Qiagen (3 mentions) Lightcycler 480 real time pcr system, by Roche (3 mentions) Lightcycler 480 sybr green 1 master mix, by Roche (3 mentions) Rna micro kit, by Qiagen (3 mentions) Ampure xp bead based clean up, by Beckman Coulter (3 mentions) Q5 high fidelity dna polymerase, by New England Biolabs (3 mentions) Nucleospin pcr clean up kit, by Macherey-Nagel (3 mentions) Hiseq 2500, by Illumina (3 mentions) Smarter race cdna amplification kit, by Takara Bio (3 mentions) Spriselect purification, by Illumina (2 mentions)

Close spelling variants of this product

Reverse transcriptase (314 citations) SMARTScribe (35 citations) SMARTScribe Reverse Transcriptase kit (11 citations) SMARTScribe Reverse Transcriptase enzymes (2 citations)

108 protocols using smartscribe reverse transcriptase

Profiling T Cell Receptor Repertoire from mRNA

Check if the same lab product or an alternative is used in the 5 most similar protocols

mRNA was purified from 10⁶ naive CD4 T cells using a mRNA direct purification kit (ThermoFisher Scientific), and cDNA was synthesized using SMARTscribe reverse transcriptase (Clontech Laboratories) to produce bead-coupled mRNA libraries. The entire volume of mRNA beads was added to 4 μL first-strand buffer, 0.5 μL 20 mM DTT, 2 μL 10 mM dNTP mix, 2 μL SMART synthesis oligo (5′-GGCGAAGCAGTGGTATCAACGCAGAGTACGCrGrGrG-3′), 0.5 μL RNase inhibitor, and 2 μl SMARTscribe reverse transcriptase (Clontech), and the reaction was incubated at 42°C for 1 h.
TCR-β V-region amplicons were generated from cDNA by PCR using indexed forward primers composed of the SMART synthesis oligo sequence fused to a P7 illumina tag, and a reverse primer within the TCR-β C region fused to a P5 illumina tag. Amplified products were purified by extraction from excised agarose gel bands and concentrated by ethanol precipitation prior to sequencing. Single-end 1 × 400-bp sequencing was performed on an Illumina MiSeq sequencer using custom read1 primers and indexing primers complementary to the amplification primer sequences. Sequence data were processed using the MiTCR utility (13 (link)) and a customized pipeline of python scripts to analyze and plot the MiTCR output.

Sood S., Brownlie R.J., Garcia C., Cowan G., Salmond R.J., Sakaguchi S, & Zamoyska R. (2016). Loss of the Protein Tyrosine Phosphatase PTPN22 Reduces Mannan-Induced Autoimmune Arthritis in SKG Mice. The Journal of Immunology Author Choice, 197(2), 429-440.

+ Open protocol

+ Expand

Bulk Sequencing of Antigen-Specific T Cells

Cited 1 time

Check if the same lab product or an alternative is used in the 5 most similar protocols

For the bulk sequencing of sorted antigen-specific T cells, we used our previously published protocol for repertoire sequencing with purified mRNA as the template with some modifications^{26 (link)}. In short, the method is based on the template switch mechanism in the reverse transcriptase which adds an anchor sequence at the 3’ end of the new synthesized ss cDNA (Clontech’s SMARTScribe TM reverse transcriptase). The template switch oligo also includes random nucleotides for unique molecular barcoding (isoC-GCGTCAGATGTGTATAAGAGACAGNNNNNNNNNNrGrGrG). The whole transcriptome was amplified with Clontech SeqAmp Polymerase. Based on the obtained ds cDNA as template TCR specific amplification was succeeded through a specific TCR constant primer (TRB: TGCTTCTGATGGCTCAAACACAGCG) using the NEB Q5 polymerase. Beckmann SPRIselect purification was used to clean the PCR product before sequencing on Illumina MiSeq. Filtering and merging of reads were done as previously described and VDJ and CDR3 annotations were assigned using IMGT/HighV-Quest (IMGT®).

Huang H., Wang C., Rubelt F., Scriba T.J, & Davis M.M. (2020). Analyzing the M. tuberculosis immune response by T cell receptor clustering with GLIPH2 and genome-wide antigen screening. Nature biotechnology, 38(10), 1194-1202.

+ Open protocol

+ Expand

Bulk Sequencing of Antigen-Specific T Cells

Cited 1 time

Check if the same lab product or an alternative is used in the 5 most similar protocols

+ Open protocol

+ Expand

Obtaining Full-Length cDNA of PsFAR Gene

Check if the same lab product or an alternative is used in the 5 most similar protocols

The SMART™ RACE cDNA Amplification Kit (Takara, Kyoto, Japan) was used to obtain full-length cDNAs of the PsFAR gene. 5’-UTR and 3’-UTR RACE cDNAs were synthesized from total RNA using SMARTScribe^TM Reverse Transcriptase (Clontech), according to the manufacturer’s instructions. Specific primers for PsFAR (Supplementary Table 6) were designed using Primer-BLAST in NCBI (https://www.ncbi.nlm.nih.gov/tools/primer-blast/). Paired with the Universal Primer Mix supplied in the kit, one pair of forward and reverse gene-specific primers were, respectively, used in the 3’ and 5’ RACE first-step PCR reactions. PCR conditions were as follows: incubation at 94 °C for 3 min; five cycles at 94 °C for 30 s, 72 °C for 3 min; five cycles at 94 °C for 30 s, 68 °C for 30 s, 72 °C for 3 min; and 25 cycles at 94 °C for 30 s, 66 °C for 30 s, 72 °C for 3 min. The final extension was 72 °C for 10 min. PCR products were purified using the FastPure Gel DNA Extraction Mini Kit (Vazyme Biotech Co., Ltd., Nanjing, China) and cloned using the pClone007 Simple Vector Kit (Tsingke Biotech, Beijing, China). Positive clones were selected and sequenced in Tsingke Biotech.

Tong H., Wang Y., Wang S., Omar M.A., Li Z., Li Z., Ding S., Ao Y., Wang Y., Li F, & Jiang M. (2022). Fatty acyl-CoA reductase influences wax biosynthesis in the cotton mealybug, Phenacoccus solenopsis Tinsley. Communications Biology, 5, 1108.

+ Open protocol

+ Expand

Comprehensive Full-Length cDNA Generation

Cited 1 time

Check if the same lab product or an alternative is used in the 5 most similar protocols

RNA was reverse transcribed (RT) using SMARTScribe Reverse Transcriptase (Clonetech). We generated full-length cDNA using a modified Smart-seq2 approach (Cole et al., 2018 (link)). During the RT reaction, a template-switch oligo and an oligodT primer were used to select for polyA+ RNA (Table S2). The RT reaction was performed in 10 μl reactions with an input of 70 ng of RNA and took place at 42°C for 1 h. After cDNA synthesis, 1 μl of 1:10 dilutions of RNAse A (Thermo Fisher) and Lambda Exonuclease (NEB) were added and incubated at 37°C for 30 min. Following the incubation, an amplification step was performed in 25-μl final volumes using KAPA HiFi ReadyMix 2X (Kapa Biosystems) containing 1 μl of the ISPCR primer (10 μM) primer. Samples were incubated at 95°C for 3 min, followed by 12 cycles of (98°C for 20 s, 67°C for 15 s, and 72°C for 4 min), with a final extension of 72°C for 5 min. Samples were purified using Agencourt AMPure XP SPRI beads (Beckman Coulter) and eluted at 25 ml. The final cDNA product was then visualized on an agarose gel to confirm distribution (Figure 2).

Byrne A., Supple M.A., Volden R., Laidre K.L., Shapiro B, & Vollmers C. (2019). Depletion of Hemoglobin Transcripts and Long-Read Sequencing Improves the Transcriptome Annotation of the Polar Bear (Ursus maritimus). Frontiers in Genetics, 10, 643.

+ Open protocol

+ Expand

Transcriptional Analysis of CotA in Synechococcus

Check if the same lab product or an alternative is used in the 5 most similar protocols

Total RNA was extracted from 50 ml S. elongatus PCC7942 cultures at an OD₇₃₀ of 0.3~ 0.5 using a Trizol (Sigma Aldrich) reagent. RNAse-free DNAse was used to remove genomic DNA. The reverse transcription reaction was carried out using SMARTScribe™ Reverse Transcriptase (Clonetech) and random primers. The resultant cDNA molecules were amplified by PCR using the following gene-specific primers: CotAF and CotAR (Table 1) for amplification of CotA and control primers PhycoBF and PhycoBR (Table 1) for amplification of the highly constitutively expressed C-phycocyanin beta-chain gene, which was used as a positive control. PCR products were analyzed by 0.8% agarose gel electrophoresis.

Liang Y., Hou J., Liu Y., Luo Y., Tang J., Cheng J.J, & Daroch M. (2018). Textile Dye Decolorizing Synechococcus PCC7942 Engineered With CotA Laccase. Frontiers in Bioengineering and Biotechnology, 6, 95.

+ Open protocol

+ Expand

Single-Cell RNA-Seq Library Preparation

Check if the same lab product or an alternative is used in the 5 most similar protocols

Single cells from each sample were manually and randomly picked by mouth pipette under fluorescent microscopy (X71, Olympus, Japan) and then transferred into 0.2 ml PCR tubes containing 2 μl cell lysis buffer. Libraries of isolated single cells were constructed following the Smart-seq2 protocol [17 (link)] with only modifications on the reverse transcription and amplification cycle.
Oligo-dT primed mRNA reverse transcription was performed with SMARTScribe reverse transcriptase (Takara, Japan) and locked by template-switching oligonucleotides (Exiqon, Denmark). After that, full-length cDNA amplification was conducted by 22 cycles of PCR amplification with HiFi-HotStart ReadyMix (KAPA Biosystems, USA) and subsequent 0.6× AMPure beads purification (BD, USA). Barcoded libraries were fragmented and tagmented with Nextera XT Library Prep kit (Illumina). Pooled libraries with unique N5-N7 barcodes were sequenced using a Hiseq 2500 platform (Illumina) with a single-end 50 base-pair length.

Yan G., Li L., Zhu S., Wu Y., Liu Y., Zhu L., Zhao Z., Wu F., Jia N., Liao C., Jiang L., Zeng Q., Wang P., Shi L., Zheng Z., Fang S., Zhang G., Tang Y, & Wang X. (2021). Single-cell transcriptomic analysis reveals the critical molecular pattern of UV-induced cutaneous squamous cell carcinoma. Cell Death & Disease, 13(1), 23.

+ Open protocol

+ Expand

Isolation and Sequencing of IgG+ Memory B Cells

Check if the same lab product or an alternative is used in the 5 most similar protocols

B cells were isolated from PBMCs using CD19 microbeads (Miltenyi Biotec) and stained with DAPI (Thermo Fisher), CD20-AF 700, IgG-APC, IgD-Pe-Cy7, IgM-FITC, and CD27-PE (all BD Biosciences) for 30 min on ice. 200,000 CD20⁺IgG⁺IgM^-IgD^-CD27^- B cells were sorted into FBS (Sigma-Aldrich) using a BD FACSAria Fusion, and RNA of sorted B cells was isolated with the RNeasy Micro Kit (QIAGEN). cDNA was generated by template-switch reverse transcription according to the SMARTer RACE 5′/3′ manual using the SMARTScribe Reverse Transcriptase (Takara) with a template-switch oligo including an 18-nucleotide unique molecular identifier. Heavy-chain variable regions were amplified with an IgG-specific nested PCR and amplicons were used for library preparation and MiSeq 2x300 bp sequencing (Illumina). Raw NGS reads were pre-processed and assembled to final sequences as previously described (Ehrhardt et al., 2019 (link)).

Schommers P., Gruell H., Abernathy M.E., Tran M.K., Dingens A.S., Gristick H.B., Barnes C.O., Schoofs T., Schlotz M., Vanshylla K., Kreer C., Weiland D., Holtick U., Scheid C., Valter M.M., van Gils M.J., Sanders R.W., Vehreschild J.J., Cornely O.A., Lehmann C., Fätkenheuer G., Seaman M.S., Bloom J.D., Bjorkman P.J, & Klein F. (2020). Restriction of HIV-1 Escape by a Highly Broad and Potent Neutralizing Antibody. Cell, 180(3), 471-489.e22.

+ Open protocol

+ Expand

Cre-mediated Conditional Knockout of PAM in Spinal Cord

Check if the same lab product or an alternative is used in the 5 most similar protocols

Spinal cords from PAM^fl/fl and GRP-Cre∷PAM^fl/fl mice were dissected and total RNA extracted using a RNeasy lipid tissue mini kit (QIAGEN, Germantown, MD) following the manufacturer’s instructions. During RNA extraction, on column DNase treatment was performed. Total RNA was reverse transcribed using SMARTScribe reverse transcriptase (Takara Bio, Mountain View, CA) and oligo(dT) 18 primer according to the manufacturer’s protocol. As a control, mock reactions lacking reverse transcriptase were performed and used as no template control during PCR. Cre-recombined PAM transcripts (for primer: CACTGGGAGTTACTGGTGTTGGAT, rev primer: TAAGGACACACCGGAACAGTCTT) or b-actin transcripts as a control (for primer: CTGGCTCCTAGCACCATGAAGATC, rev primer: CTAGAAGCACTTGCGGTGCACG) were amplified by PCR using a Phusion® hot start flex polymerase (New England Biolabs, Ipswich, MA) according to the manufacturer’s instructions and detected on 2% agarose gels.

Solinski H.J., Kriegbaum M.C., Tseng P.Y., Earnest T.W., Gu X., Barik A., Chesler A.T, & Hoon M.A. (2019). Nppb Neurons Are Sensors of Mast Cell-Induced Itch. Cell reports, 26(13), 3561-3573.e4.

+ Open protocol

+ Expand

Quantitative Gene Expression Analysis in hiPSC-CMs

Check if the same lab product or an alternative is used in the 5 most similar protocols

hiPSC-CMs were cultured for 4 and 7 days under the various conditions at which point total RNA was isolated using the RNeasy kit (Qaigen). First-strand cDNA was synthesized with Smartscribe Reverse Transcriptase (Takara Bio USA) and random hexamer primers (Fisher Scientific). Target gene mRNA levels were assessed by quantitative RT-PCR with LightCycler 480 SYBR Green I Mastermix (Roche) and a LightCycler 480 Real-Time PCR System (Roche). Relative changes in mRNA expression were determined by the ∆∆Ct method, expressed as levels relative to 18 S.

Cortes D., McTiernan C.D., Ruel M., Franco W., Chu C., Liang W., Suuronen E.J, & Alarcon E.I. (2020). BEaTS-α an open access 3D printed device for in vitro electromechanical stimulation of human induced pluripotent stem cells. Scientific Reports, 10, 11274.

+ Open protocol

+ Expand

About PubCompare

Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.

We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.

However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.

Ready to get started?

Revolutionizing how scientists
search and build protocols!