Total RNA was prepared using the Universal RNA extraction kit (9767; TaKaRa Bio, Inc., Japan), and cDNA was generated using PrimeScript RT master mix reagent (RR036A; TaKaRa Bio, Inc., Japan) according to the manufacturer’s instructions. Quantitative reverse transcription-PCR (qRT-PCR) was performed using iTaq Universal SYBR green supermix (Bio-Rad Laboratories Shanghai, Ltd., Shanghai, China) to detect the mRNA expression levels of the indicated genes. The expression levels of the target genes were normalized by subtracting the corresponding GAPDH (glyceraldehyde-3-phosphate dehydrogenase) threshold cycle (CT) value. The following primers were used: P4HB forward (5′-GGCTATCCCACCATCAAGTTC -3′) and reverse (5′-TCACGATGTCATCAGCCTCTC -3′) and GAPDH forward (5′-GGAGCGAGATCCCTCCAAAAT -3′) and reverse (5′-GGCTGTTGTCATACTTCTCATGG -3′).
Universal rna extraction kit
Manufactured by Takara Bio
Sourced in China, Japan
The Universal RNA Extraction Kit is a laboratory equipment designed for the efficient extraction and purification of total RNA from a variety of sample types. It utilizes a simple and straightforward protocol to isolate high-quality RNA for downstream applications.
Automatically generated - may contain errors
Lab products found in correlation
Primescript rt reagent kit, by Takara Bio (4 mentions)
Cfx96 real time pcr detection system, by Bio-Rad (4 mentions)
Primescript rt reagent kit with gdna eraser, by Takara Bio (3 mentions)
Tb green premix ex taq 2, by Takara Bio (3 mentions)
Reverse transcription kit, by Takara Bio (3 mentions)
Steponeplus pcr system, by Thermo Fisher Scientific (2 mentions)
Sybr green pcr master mix, by Roche (2 mentions)
Primescript rt master mix, by Takara Bio (2 mentions)
Nanodrop, by Thermo Fisher Scientific (2 mentions)
Sybr green pcr master mix, by Takara Bio (2 mentions)
Steponeplus real time pcr system, by Thermo Fisher Scientific (2 mentions)
Prime script rt master mix reagent, by Takara Bio (1 mentions)
Itaq universal sybr green supermix, by Bio-Rad (1 mentions)
Sybr premix ex taq kit, by Takara Bio (1 mentions)
Dna engine 7500 continuous fluorescence detection system, by Thermo Fisher Scientific (1 mentions)
Cfxtm manager 3, by Bio-Rad (1 mentions)
Primescript rt master mix kit, by Takara Bio (1 mentions)
Tb green premix ex taq 2 tli rnaseh plus, by Takara Bio (1 mentions)
Abi quanrstudio5 real time pcr detection system, by Thermo Fisher Scientific (1 mentions)
Rna amplification kit, by Takara Bio (1 mentions)
24 protocols using universal rna extraction kit
1
Total RNA Extraction and RT-qPCR
2
Quantitative Analysis of APPV Expression
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA was extracted from tissues using a Universal RNA Extraction Kit (Takara Biotech, Dalian, China), and reverse transcription was performed to generate cDNAs using a PrimeScript RT Reagent Kit (Takara Biotech, Dalian, China) according to the manufacturer’s instructions. Relative expression levels of APPV in tissues were determined by real-time quantitative PCR using a DNA Engine 7500 Continuous Fluorescence Detection System (Applied Biosystems, CA, USA) and a SYBR Premix Ex Taq Kit (Takara Biotech, Dalian, China). The specific qPCR primers used were E2-F (GCAGCCGATAAGACAGAG), E2-R (GATAGCCATACACCTTCCCT), β-actin-F (GGTGGGAATGGGTCAGAAGGA), and β-actin-R (TGGCTGGGGTGTTGAAGGTC). Relative expression levels of APPV in tissues were calculated by normalizing the levels of gene transcripts to that of β-actin using a relative standard curve method with the 2−ΔΔCt formula. Statistical analysis was performed using SPSS version 20.0, and the figures were made using GraphPad Prism (GraphPad Software, La Jolla, CA). One-way analysis of variance and Student’s t-test were used to determine the statistical significance of differences in the relative expression levels of APPV in different tissues. Differences were considered statistically significant at P < 0.05.
3
Quantitative Real-Time RT-PCR Analysis
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA was extracted from each sample by using a universal RNA extraction kit (Takara, Xi'an, China). cDNA was synthesized using 500 ng total RNA and 2 μL PrimeScript RT Master Mix (Takara, Xi'an, China) according to the manufacturer's instructions. Quantitative real-time reverse-transcriptase PCR was performed using TB Green Premix Ex Taq II (Takara, Xi'an, China) on a CFX96 Real-Time PCR Detection System (Bio-Rad Laboratories Inc., USA). The primers used in this study are listed in Table S1 . Glyceraldehyde-3-phosphate dehydrogenase (GAPDH) was used as the control.
4
Quantitative Analysis of SPARC Expression
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA was extracted from cells and tissues using a Universal RNA Extraction Kit (Takara Bio Inc., Tokyo, Japan). RNA (500 ng) was reverse transcribed to cDNA using the PrimeScript RT reagent Kit. The primer sequences designed for quantitative real-time polymerase chain reaction (qRT-PCR) were as follows: Forward primer, 5-CGAGCTGGATGAGAACAAC-3, reverse primer, 5-AAGAAGTGGCAG GAAGAGTC-3. The housekeeping gene GAPDH was used as an internal control to confirm the success of RT reaction. The primer sequences for GAPDH were as follows: Forward primer, 5-CACAAGAAGGTGGTGAAGCAG-3, reverse primer, 5’-AAAGGTGGAGGAGTGGGTCT-3. PCR amplification was carried out with an initial denaturation at 95 °C for 5 s, followed by 40 cycles of 95 °C for 4 s, 60 °C for 34 s, and a final extension step of 95 °C for 15 s, 60 °C for 1 min, and 95 °C for 15 s. The expression level of SPARC in four GC cell lines was analyzed using GES-1 cells as the relative standard. The results of qRT-PCR were subsequently analyzed by the 2-△△Ct method, and statistical tests were performed.
5
RT-qPCR Gene Expression Analysis
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA was extracted using a Universal RNA Extraction kit (Takara Bio, Inc., Otsu, Japan) and reverse transcribed into cDNA with PrimeScript RT Master Mix kit (Takara Bio, Inc., Otsu, Japan). The RT reaction was performed by incubating the samples at 37°C for 15 min, followed by incubation at 85°C for 5 sec and 4°C for 5 min. Equal quantities of cDNA were used for RT-PCR analysis with a SYBR Premix Ex Taq II analysis kit (Takara Bio, Inc.). The thermocycling conditions were as follows: 95°C for 5 min followed by 45 cycles of denaturation at 95°C for 5 sec, annealing at 60°C for 15 sec, and extension at 72°C for 30 sec. qPCR analyses were performed with the Bio-Rad CFX96™ Real-Time PCR detection system and analyzed using CFXTM manager 3.0 (Bio-Rad Laboratories, Inc., Hercules, CA, USA). The specific primers used are listed in Table II . Relative expression levels were normalized to the expression of GAPDH and were quantified using the comparative 2-ΔΔCq method (30 (link)).
6
Culturing and RNA Extraction of Lung Cancer Cells
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The lung cancer cell lines A549 and PC-9 used in this study were stored in our laboratory and cultured under conventional conditions (5% CO2 and 37°C). To produce cDNA, total RNA was extracted and reverse transcribed using a Universal RNA Extraction Kit (TaKaRa, Shanghai, China). The primers used for qPCR are shown in Supplementary file 1 .
7
Quantitative Real-Time PCR Analysis
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
A commercially RNA extraction kit (TaKaRa Universal RNA Extraction Kit, Dalian, China) was used to isolate the total RNA from hippocampus and colon tissues according to the manufacturer’s instruction. The synthesis of cDNA uses PrimeScript™ RT reagent Kit (TaKaRa; Dalian, China) according to the manufacturer’s instructions. The gene-specific primers used in the test were supplied in Supplementary Table 1 . Reactions were performed using TB Green ® Premix Ex Taq ™ II (Tli RNaseH Plus) (TaKaRa; DaLian, China) on ABI QuanrStudio5 Real-time PCR Detection System (Life technologies, Singapore) with the following conditions: 95 °C for 30 s, followed by 40 cycles of 95 °C for 5 s, 60 °C for 30 s. The expressions were calculated as a relative value after normalization to β-actin mRNA.
8
Hepatic RNA Extraction and qRT-PCR
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Then, 400 μl lysis buffer, three grinding beads, and 50 mg hepatic tissue were mixed in a grinding tube and subsequently broken with a homogenizer (5000 rpm, 20 seconds). The tube was then centrifuged (12000 rpm, 5 min, 4°C), and 300 μl of supernatant was placed in a new 1.5 ml RNase-free tube. Next, RNA was extracted using a Universal RNA Extraction kit. The reverse transcriptase reaction was performed for 15 min at 37°C and 5 seconds at 85°C. Finally, a 10 μl PCR mix was applied, including 2 μl cDNA, 5 μl 2× TB green, 0.4 μl forward primer (10 μm), 0.4 μl reverse primer (10 μm), and 2.2 μl ddH2O.
The Universal RNA Extraction kit (cat: 9767; lot: AJ82351A), reverse transcription (RT) kit (cat: RRO36A; lot: A140832A), and RNA amplification kit (cat: RR820A; lot: A140778A) were purchased from Takara.
We designed primer sequences according to the mRNA sequences obtained from the NCBI database (https://www.ncbi.nlm.nih.gov ) and PrimerBank (https://pga.mgh.harvard.edu/primerbank/ ), synthesized by Sangon Biotech, as shown in Table 1 .
The Universal RNA Extraction kit (cat: 9767; lot: AJ82351A), reverse transcription (RT) kit (cat: RRO36A; lot: A140832A), and RNA amplification kit (cat: RR820A; lot: A140778A) were purchased from Takara.
We designed primer sequences according to the mRNA sequences obtained from the NCBI database (
9
RT-qPCR Analysis of Pluripotency Genes
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total cellular RNA was extracted using a Universal RNA Extraction Kit (Takara, Beijing, China) according to the manufacturer’s instructions. The mRNA was reverse-transcribed using a PrimeScript IV 1st strand cDNA Synthesis Mix (Takara). Then, RT-qPCR of the cDNA was performed using a TB Green Premix Ex Taq™ II FAST qPCR (Takara) on a ViiA7 System (Thermo Fisher Scientific, Waltham, MA, USA). The primer sequences used in this study were designed at the NCBI website (https://www.ncbi.nlm.nih.gov/ , accessed on 10 April 2023) and were as follows: SOX2 (forward, 5′-AACTCCATGACCAGCTCGCAGA-3′ and reverse, 5′-GGACTTGACCACCGAACCCAT-3′), NANOG (forward, 5′-TGGCTCTGTTTTGCTATATCCC-3′ and reverse, 5′-CATTACGATGCAGCAAATACGAGA-3′), OCT4 (forward, 5′-TATGCAAAGCAGAAACCCTCGT-3′ and reverse, 5′-TTCTCCAGGTTGCCTCTCACTCG-3′) and GAPDH or actin (forward, 5′-GGAGCGAGATCCCTCCAAAAT-3′ and reverse, 5′-GGCTGTTGTCATACTTCTCATGG-3′).
10
Quantitative RNA Expression Analysis of Key Regulators
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA of LIHC tissues and paired non-tumor tissues or HCC cells treated with negative control siRNA, ITGB1-specific siRNA, ITGB1-specific siRNA plus PXN, ITGB1-specific siRNA plus YWHAZ, and ITGB1-specific siRNA plus PXN plus YWHAZ was isolated using the Universal RNA Extraction Kit (TaKaRa, Japan) according to manufacturer’s instructions. Then, the total RNA of tissues or cells was reverse-transcribed to cDNA by 5X PrimeScript RT Master Mix (TaKaRa, Japan). PowerUp™ SYBR™ Green Master Mix (Applied Biosystems, United States) and QuantStudio™ 1 Real-Time PCR instrument (Applied Biosystems, United States) were applied to quantitatively evaluate the levels of targeted gene expression. GAPDH was set as the internal control. QuantStudio™ Design and Analysis software v1.5.1 (Applied Biosystems, United States) was employed to analyze raw data and define relative quantity (RQ). The sequences of the primers are listed in Supplementary Table S2 .
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!