The 70 nt-long 5′SLA (5′-AGTTGTTAGTCTACGTGGACCGACAAAGACAGATTCTTTGAGGAAGCTAAGCTTAACGTAGTTCTAACAG-3′) and 79 nt-long 3′SL (5′-AGATCCTGCTGTCTCCTCAGCATCATTCCAGGCACAGAACGCCAGAAAATGGAATGGTGCTGTTGAATCAACAGGTTCT-3′) RNAs were generated by in vitro transcription using the MEGAscript Kit (Life Technologies) following the product manual. The DNA templates were PCR amplified from a minireplicon construct followed by purification by gel extraction using the QIAquick Gel Extraction Kit. The synthesized RNAs were purified by the lithium chloride precipitation method following the MEGAscript Kit (Life Technologies) manual, followed by analysis on a 1.5% agarose gel with 1× TAE buffer under 100V for 1 h. GelRed (Biotium) was added into agarose at 1:10,000 v/v right before gel casting for detection of RNA using the Chemidoc Imaging system.
Megascript kit
Manufactured by Thermo Fisher Scientific
Sourced in United States, Switzerland, Germany
The MEGAscript kit is a high-performance in vitro transcription system designed for the efficient synthesis of large amounts of RNA. The kit uses T7 RNA polymerase to generate high yields of RNA from DNA templates.
Automatically generated - may contain errors
Lab products found in correlation
Mmessage mmachine kit, by Thermo Fisher Scientific (15 mentions)
Megaclear kit, by Thermo Fisher Scientific (12 mentions)
Pierce magnetic rna protein pull down kit, by Thermo Fisher Scientific (10 mentions)
Nanodrop 2000, by Thermo Fisher Scientific (8 mentions)
Spectramax, by Molecular Devices (7 mentions)
Pierce rna 3 end desthiobiotinylation kit, by Thermo Fisher Scientific (5 mentions)
Pgem t easy vector, by Promega (5 mentions)
Pierce rna 3 desthiobiotinylation kit, by Thermo Fisher Scientific (5 mentions)
Nanodrop spectrophotometer, by Thermo Fisher Scientific (4 mentions)
Trizol reagent, by Thermo Fisher Scientific (4 mentions)
Turbo dnase, by Thermo Fisher Scientific (4 mentions)
Antarctic phosphatase, by New England Biolabs (4 mentions)
Rneasy mini kit, by Qiagen (4 mentions)
Nanodrop 2000 spectrophotometer, by Thermo Fisher Scientific (4 mentions)
Wheat germ extract system, by Promega (3 mentions)
Top10 chemically competent e coli, by Thermo Fisher Scientific (3 mentions)
T7 and sp6 rna polymerase, by Roche (3 mentions)
Magnetic rna protein pull down kit, by Thermo Fisher Scientific (3 mentions)
Nanodrop 8000 spectrophotometer, by Thermo Fisher Scientific (3 mentions)
Transit mrna transfection kit, by Mirus Bio (3 mentions)
251 protocols using megascript kit
1
Synthesis and Characterization of 5'SLA and 3'SL RNAs
2
Establishment of HCV Jc1 Infection Model
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Huh7.5 cells were maintained in Dulbecco's modified minimal Eagle medium (DMEM) (Invitrogen, Carlsbad, CA) supplemented with 10% fetal bovine serum (3 (link)). A plasmid containing the full-length HCV Jc1 cDNA was cloned from chemically synthesized DNA oligomers in collaboration with Ju-Tao Guo and Jinhong Chang (Baruch S. Blumberg Institute, Doylestown, PA, USA). Infectious HCV Jc1 was obtained by transcribing HCV Jc1 RNA in vitro using the Megascript kit (Ambion), followed by electroporation into Huh7.5 cells and collection of infectious viral particles from the cell culture (58 (link)). HCV RNA was transcribed in vitro using the Megascript kit (Ambion) and electroporated into Huh7.5 cells (59 (link)). Generation of a virus stock and determination of virus titers (50% tissue culture infective doses [TCID50] per milliliter) were carried out as described in previous work (60 (link)). In general, infection of Huh7.5 cells at a multiplicity of infection (MOI) of 0.015 for 4 days resulted in virus yields of 0.5 × 104 to 0.5 × 105 TCID50/ml (61 (link)).
3
Synthesis and Characterization of Luciferase Constructs for Translation Assays
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The luciferase constructs used in translation assays consisting of the firefly luciferase gene (luc2, Promega) flanked by the indicated viral genomic 5′ and 3′ UTRs [32 (link)] were linearized with Sma I and transcribed using the MEGAscript kit (Ambion). CAluc, which is a capped transcript containing nonviral UTRs described previously [73 (link)], was linearized with EcoICRI, transcribed with the MEGAscript kit (Ambion) and post-transcriptionally capped using the T7 mScript Standard mRNA Production System (Cell Script).
For trans-inhibition and structure probing experiments, the PTE sequences from the indicated viruses present in the universal SHAPE cassette [15 (link),32 (link)] were linearized with either HpaI (giving only PTE transcript for trans-inhibition studies) or SmaI (which adds a 3′-terminal extension on the PTE providing a primer binding site for SHAPE experiments) and transcribed in vitro using the MEGAshortscript kit (Ambion). All transcripts were purified by phenol/chloroform extraction and ethanol precipitation. RNA concentrations were determined spectrophotometrically and integrity was verified by 0.8% agarose gel electrophoresis.
For trans-inhibition and structure probing experiments, the PTE sequences from the indicated viruses present in the universal SHAPE cassette [15 (link),32 (link)] were linearized with either HpaI (giving only PTE transcript for trans-inhibition studies) or SmaI (which adds a 3′-terminal extension on the PTE providing a primer binding site for SHAPE experiments) and transcribed in vitro using the MEGAshortscript kit (Ambion). All transcripts were purified by phenol/chloroform extraction and ethanol precipitation. RNA concentrations were determined spectrophotometrically and integrity was verified by 0.8% agarose gel electrophoresis.
4
Synthesizing dsRNA for Laccase2 and GFP in C. puncticollis
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The dsRNAs for laccase2 (362 bp) and gfp (495 bp) were synthesized using the MEGAscript kit (Ambion). The C. puncticollis transcriptome was searched for the laccase2 sequence using the homologous sequence from T. castaneum as a query. The fragment was amplified by PCR using cDNA of second-instar C. puncticollis larvae as template, prepared with SuperScript First-Strand Synthesis System (Invitrogen). The primers used for the PCR are listed in Table 4 . The PCR products were cloned into the pJET1.2/blunt cloning vector (Thermo Scientific). The insertions were confirmed by Sanger sequencing. The dsRNA templates were produced by PCR using DNA plasmids linearized with NcoI and primers with a T7 promoter region (TAATACGACTCACTATAGGGAGA) at the 5’ end of each primer (Table 4 ). The PCR products were purified using the CyclePure E.Z.N.A. kit (Omega Bio-Tek) and immediately used for in vitro transcription using MEGAscript kit (Ambion) according to the manufacturer’s instructions. Nuclease-free water was used for dsRNA elution. The dsRNA synthesis was verified by gel electrophoresis and quantified in a NanoDrop ND-1000 (Thermo Scientific).
5
Transcription Factors in Neural Development
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
5′capped and polyadenylated mRNAs encoding TFs expressed by cells in the neural plate (foxd4l1.1; Sullivan et al., 2001 (link)), neural crest (foxd3, Sasai et al., 2001 (link); msx1, Suzuki et al., 1997 (link); Tribulo et al., 2003 (link); Monsoro-Burq et al., 2005 (link); zic1, zic2, and zic3, Nakata et al., 1997 (link), Nakata et al., 1998 (link)), PPR (six1;Brugmann et al., 2004 (link)), or epidermis (dlx5, Papalopulu and Kintner, 1993 (link); Luo et al., 2001 (link)), as well as a nucleus-localized β-galactosidase (nβgal) as a lineage tracer, were synthesized in vitro (mMessage mMachine kit, ThermoFisher). Antisense RNA probes for in situ hybridization (ISH) were synthesized in vitro (MEGAscript kit; ThermoFisher) as previously described (Yan et al., 2009 (link)).
6
Synthesis and Evaluation of mRNA Constructs
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
In vitro transcription was carried out with the MEGAscript™ Kit (Thermo Fisher) following manufacturer’s instructions. For CERES and CERES∆563-570 mRNA synthesis, PCR products that contained the T7-promoter and -terminator were amplified from the pGBKT7-CERES or pGBKT7-CERES∆563-570 vectors. To obtain the Luciferase mRNA we performed a PCR to introduce the T7 promoter sequence using pcDNA-Luciferase as template. mRNAs were capped using Vaccinia Capping System (New England Biolabs).
In vitro translation was done using the Wheat Germ Extract (WGE) system (Promega). Luciferase activity was measured using 5 µL of in vitro translation reaction as described in manufacturer’s protocol. Statistical analysis was performed with GraphPad Prism Software (GraphPad Software Inc.).
In vitro translation was done using the Wheat Germ Extract (WGE) system (Promega). Luciferase activity was measured using 5 µL of in vitro translation reaction as described in manufacturer’s protocol. Statistical analysis was performed with GraphPad Prism Software (GraphPad Software Inc.).
7
Synthesis and Evaluation of mRNA Constructs
8
SARS-CoV-2 RNA Extraction and Transcription
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Cas13 RNA Orf1ab and S targets were obtained by RT-PCR from total RNA extracted from SARS-CoV-2 infected cells (donated by Isabel Sola and Sonia Zúñiga, CNB) using the SuperScript™ III One-Step RT-PCR System with Platinum™ Taq DNA Polymerase (Thermo Fisher). Primers used here containing a 5′ T7 promoter sequence were described by Zhang et al. [19 ] and ordered to IDT. RNA template NASBA was obtained by PCR from pSL_WH_SARS2_S plasmid (donated by Isabel Sola and Sonia Zúñiga, CNB). Later, a T7 RNA transcription was performed using the MEGASCRIPT Kit (Thermo Fisher) for 16 h at 37 °C following the manufacturer's instructions.
After T7 RNA transcription, the samples were treated with TurboDNase from MEGASCRIPT Kit for 25 min at 37 °C. Next, a phenol-chloroform RNA extraction was performed following the kit indications with some variations. 115 μL RNase-free water and 15 μL Ammonium Acetate stop solution were added to the samples and mixed well. Next, samples were extracted with phenol and then with chloroform. Then, RNA was precipitated by adding ethanol. Samples were cooled for 2 h at −20 °C. Then, samples were centrifuged for 20 min at 4 °C and at maximum speed. The supernatant was decanted until ethanol was completely removed. The RNAs obtained were diluted in RNase-free water.
After T7 RNA transcription, the samples were treated with TurboDNase from MEGASCRIPT Kit for 25 min at 37 °C. Next, a phenol-chloroform RNA extraction was performed following the kit indications with some variations. 115 μL RNase-free water and 15 μL Ammonium Acetate stop solution were added to the samples and mixed well. Next, samples were extracted with phenol and then with chloroform. Then, RNA was precipitated by adding ethanol. Samples were cooled for 2 h at −20 °C. Then, samples were centrifuged for 20 min at 4 °C and at maximum speed. The supernatant was decanted until ethanol was completely removed. The RNAs obtained were diluted in RNase-free water.
9
Quantitative RNA-seq of Arabidopsis under High Light
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Poly(A) RNA spike-in control was transcribed in vitro using the MEGAscript kit (Thermo Fisher, USA)55 . Total RNA was extracted from equal masses of Seven-day-old Col-0 and vir-1 seedling after 4-h HL treatment using the TRIzol reagent (Invitrogen, USA) and was added with the spike-in control. Poly(A) RNA, along with the spike-in, was purified using a DynabeadsTM mRNA purification kit (Thermo Fisher, USA). The ratio of poly(A) RNA to spike-in RNA was quantified by total RNA Pico Chip analysis using an Agilent 2100 Bioanalyzer55 . For quantitative RNA-seq, equal masses of Seven-day-old Col-0 and vir-1 seedling after 4-h HL treatment were used. After total RNA isolation, External RNA Controls Consortium (ERCC) RNA spike-in control (Ambion) was added to each isolated total RNA sample55 . A NEBNext® UltraTM RNA Library Prep Kit for Illumina (NEB) was used to construct the library, Sequencing was performed by LC-Bio Technology CO., Ltd (Hangzhou, China).
10
RNAi Knockdown and Rescue Protocol
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!