Mmp 9

The concentrations of total p70-S6K (KHO0571), p21WAF1/Cip1 (KHO5421), MMP-9 (KHС3061), active caspase-3 (KHO1091) (Invitrogen, Camarillo, CA, USA), and TGFβ1 (BMS249/4) (eBioscience, Vienna, Austria) were determined in the isolated PBMCs using commercially available enzyme linked immunosorbent assay (ELISA) kits according to the manufacturer's instructions. For mTOR protein expression, we evaluated the levels of p70-S6K, an mTOR direct target for phosphorylation, which is used as a readout of mTOR activity [30 (link), 31 (link)], as mTOR ELISA kits are not available in Russia.
The results were expressed per µg of protein measured in the PBMC lysates. The PBMC lysates were obtained using Cell Extraction Buffer containing 10 mM Tris, pH 7.4, 100 mM NaCl, 1 mM EDTA, 1 mM EGTA, 1 mM NaF, 20 mM Na₄P₂O₇, 20 mM Na₃VO₄, 1% Triton X-100, 10% glycerol, 0.1% SDS, and 0.5% deoxycholate (Invitrogen, Camarillo, CA, USA) supplemented with Protease Inhibitor Cocktail (Sigma-Aldrich, Inc., St. Louis, USA) and 1 mM PMSF (Sigma-Aldrich, Inc., St. Louis, USA) according to the manufacturer's instructions. The total protein concentration in the cell lysates was quantified using the Bradford method [32 (link)].

Total RNA was extracted using TRIzol reagent (Invitrogen). Reverse transcription‐PCR was performed with M‐MLV (Promega, Madison, WI, USA) following standard protocols. For the TaqMan‐based real‐time reverse transcription–polymerase chain reaction (RT‐PCR) assays, ABI 7900 HT Sequence Detection system (Applied Biosystem, Foster City, CA) was used. For quantitative PCR of mRNA, the MMP‐2, MMP‐9, and GAPDH primers were purchased from Invitrogen (Life Technology). EzOmics SYBR qPCR kit was purchased from Biomics. Amplification procedure was 94°C for 5 min., followed by 30 cycles at 94°C for 30 sec., 61°C for 45 sec., finally 72°C for 10 min. The primers used were as follows: (i) human MMP‐2, forward primer: 5′‐GACAACGCCCCCATACCAG‐3′, and reverse primer: 5′‐CACTCGCCCCGTGTGTTAGT‐3′; (ii) human MMP‐9, forward primer: 5′‐ACGCAGACATCGTCATCCAGT‐3′, and reverse primer: 5′‐GGACCACAACTCGTCATCGTC‐3′; (iii) human GAPDH, forward primer: 5′‐AAGGTCGGAGTCACCGGATT‐3′, and reverse primer: 5′‐AAGGTCGGAGTCACCGGATT‐3′.