7500 real time thermal cycler

Aortas from 3- and 9-week-old rats were homogenized and total RNA was extracted using TRIzol (Life Technologies, USA). RNA integrity was checked in agarose gels, and 1.0 µg RNA was used for reverse transcriptase reactions. Gene expression analysis was performed using the FastStart SYBR Green Master (Rox) kit (Roche Applied Science, USA) and a 7500 Real Time Thermal Cycler (Applied Biosystems, USA). Specific primers for adenylyl cyclase subtypes and the calcium-related protein RyR3 target genes are shown in Table 1.
Relative gene expression was normalized to the constitutive expression of α-actin. Gene expression values were determined using the 2^-ΔΔCT formula. Data in figures represent 1 of the 5 different experiments. AR/actin densitometry value ratios were calculated for each group and reported as means±SE.

The genomic DNA was isolated from adult animals using the DNeasy Tissue and Blood kit (QIAGEN). A quantitative PCR (qPCR) analysis was performed in a 7500 Real-time Thermal cycler (Applied Biosystems) using the Power SYBR master mix (Applied Biosystems) with the following parameters: 95°C for 10 min and 40 cycles of 95°C for 5 s, 58°C for 10 s and 72°C for 34 s. The primers for ama-1, vps-45, ben-1, sid-1 were designed within an exon for each gene using the Primer3 software. The utilized primers were as follows: qPCR#ama-1_forward, AGATGGACCTCACCGACAAC; qPCR#ama-1_reverse, 5′-CTGCAGATTACACGGAAGCA-3′; qPCR#vps-45_forward, 5′-TGCGTGAGGTTCAAGAAGTG-3′; qPCR#vps-45_reverse, 5′-AACAGCTGGAGCCTTTTTCA-3′; qPCR#ben-1_forward, 5′-TTGGCTCCGATTTGATTACC-3′, qPCR#ben-1_reverse, 5′-TGTTTCCCCTCTACGTGACC-3′, qPCR#sid-1_forward, 5′- ACTGACGGAAAACTGCTCAATC-3′; and qPCR#sid-1_reverse, 5′- AAAGCCTACCGCCTATCCTG-3′.
The data were normalized to the ama-1 gene, and the copy number of each transgene was calculated by comparing it to the amount of wild-type N2 endogenous genes.

Total RNA was extracted from the from colon tissue using the DNA/RNA/PROTEIN Kit purification plus (NORGEN BioTek Corp., Thorold, ON, Canada) following the manufacturer’s instructions. The RNA concentration was determined by measuring the absorbance at 260 nm. One microgram of RNA was used for first-strand cDNA synthesis with Revert Aid H Minus First Strand cDNA Synthesis Kit (Thermo Fisher Scientific, Waltham, MA, USA). Gene expression was carried out using the Fast Start SYBR Green Master kit (Applied Biosystems, Foster City, CA, USA), using a 7500 Real-Time Thermal Cycler (Applied Biosystems). Relative gene expression values were normalized to the constitutive expression of the RPLP0 gene. Specific primers for target genes are shown in Supplementary Table S1.