Sc 108065

Control, HBO1, DDB2 and XPC shRNA plasmids were purchased from Santa Cruz (sc-108065, sc-35530B-SH, sc-37799-SH and sc-37805-SH). The shRNA sequences used in this study are as follows: shHBO1-2, 5′-AAG CCCTTCAGATGCTCAAGT-3′; shControl-2, AAGAGGAGCATATTGGGAAGA; siSNF2H, 5′-CGCUCUCCAUCGUAUGUAAAATT-3′; SNF2H-2, 5′-CCGGGCAAAUAGAUUCGAGUAUUUA-3′; siDDB2-2, 5′-UCACUGGGCUGAAGUUUAA-3′; siXPC–2, 5′-UAGCAAAUGGCUUCUAUCGAA-3′; siCSB, 5′-GCAGUAACUUCUAAUCGAAUU-3′; and siCSB-2, 5′-GAAGAGUUGUCAGUGAUUA-3′. siRNA oligonucleotides targeting UVsS-A was purchased from Nippon EGT (sequences can be obtained from the company’s website).
HeLa cells were transfected with HBO1 shRNA plasmid DNA and DDB2 shRNA plasmid DNA using X-tremeGENE 9 DNA reagents (Roche), in accordance with the manufacturer’s protocol. Primary fibroblasts (normal, XPE, XPC, XPA and UVsS-A) were infected with Control shRNA Lentiviral Particles (sc-108080, Santa Cruz) or HBO1 shRNA Lentiviral Particles (sc-35530-v, Santa Cruz), in accordance with the manufacturer’s protocol.

The two distinct lentiviral ERK1/2 shRNAs, with non-overlapping shRNA sequences, were provided by Dr. Chen at Fudan University (Shanghai, China). The scramble control shRNA were purchased from Santa Cruz Biotech (sc-108065). All sequences were verified by commercial sequencing (Suzhou Jikai). OS cells were infected with lentiviral shRNA at a multiplicity of infection (MOI) of 10. Afterwards, cells were maintained with puromycin (0.5 μg/mL) to establish stable cells. ERK1/2 knockdown in stable cells was verified by Western blotting assay.

The two distinct lentiviral Ppm1e shRNAs were provided again by Dr. Cui [20 (link)]. The scramble control shRNA (sc-108065) and AMPKα1 shRNA (sc-45312-V) were purchased from Santa Cruz Biotech (Shanghai, China). Osteoblastoma cells were seeded onto six-well plates with 50–60% confluence. Ten μL/mL of lentiviral shRNA was added directly to cultured cells for 24 hours. Afterwards, puromycin (1 μg/mL, Sigma) was added to the culture medium for another 48 hours. The knockdown of targeted protein (Ppm1e or AMPKα1 ) was verified by Western blotting assay and/or qRT-PCR assay.