Superscript 3 platinum one step qrt pcr kit w rox

Genotype-specific semi-quantitative real time (q) RT-PCR was utilized to detect RNA from NiV-M and NiV-B-infected supernatants. qRT-PCR on NiV-M-infected samples was performed using primers and probe targeting the viral nucleoprotein gene as described by Guillaume et al. (2004). For specific detection of NiV-B, primers were designed to cover the fusion gene non-coding region (NCR) containing a 6-nucleotide insert that is absent in NiV-M in order to serve as a specific differential assay. Sequences of assay components, using numbering based on Nipah Bangladesh Accession # AY988601, are as follows:
NiV-B_6503_Forward: 5′ GTGTTAAACCTAGGAGACCCTTC 3′
NiV-B_6631_Reverse: 5′ GGTCTACCAACTGCTTTGATTTG 3′
NiV-B_Probe: /56-FAM/AGTCAGGTCGCGGGAATACAAACA/ZEN//3IaBkFQ/
Mastermix for qRT-PCR was prepared using the Invitrogen SuperScript™ III Platinum™ One-Step qRT-PCR Kit w/ROX according to manufacturer’s specifications, using 5 pmol of each NiV primer and 6 pmol of NiV-specific probe per reaction. Reaction conditions were as follows: 50 °C for 15 min, 95 °C for 2 min, and 40 cycles of 95 °C for 15 s followed by 60 °C, 30 s. Runs were performed using a Rotor-Gene Q (Qiagen, Software version 2.3.1.49) and semi-quantitative results were calculated based on a plasmid-based standard curve for NiV-B fusion gene or NiV-M nucleoprotein gene as appropriate.

All samples of various developmental stages (larvae, pupae, and adults) were processed at the Unité des Virus Emergents in Marseille. Before processing, L1 and L4 were washed in physiological solution to remove larval feces and particles of infectious food. Each sample was homogenized individually in 600 μL of Eagle minimal essential medium (EMEM) supplemented with 7% fetal bovine serum, 1% penicillin-streptomycin, and 1% L-glutamine (200 mM) using a Mixer Mill MM300 (Qiagen, Courtaboeuf, France) in the presence of a 3-mm tungsten bead. The resulting homogenate was centrifugated at 5000 g for 5 min to separate supernatant. 200 μL of supernatant was processed further and rest was stored at −80 °C. Viral nucleic acid was extracted by the Virus Extraction minikit (Qiagen) by BioRobot EZ1-XL Advanced (Qiagen) and eluted into 90 μL. Five microliters of this solution was used for real-time RT-PCR performed by SuperScript® III Platinum® One-Step qRT-PCR Kit w/ROX (Invitrogen, Villebon sur Yvette, France) according to manufacturer’s protocol on a CFX96 real-time system (Bio-Rad, Marnes la Coquette, France): (i) 48 °C for 30 min, (ii) 95 °C for 2 min, (iii) 95 °C for 30s, (iv) 60 °C for 1 min; steps (iii) and (iv) were repeated 45x. Primers and probes designed for the nucleoprotein gene specific for MASV were described previously [14 (link)].