Total RNA of PC-12 cells treated was purified using TRIZOL (Sigma, USA), and the reaction was performed with the commercial kit KAPA SYBR FAST qPCR (KapaBiosystems, USA) and the equipment for Stratagene MX3000P (ThermoFisher, USA) real-time PCR. The qPCR was performed using RNA as a template, and the primers were ordered from Integrated DNA Technologies (Coralville, USA): BcL-2 (Forward: GATGACTGAGTA CCTGAACCG, Reverse: CAGAGACAGCCAGGAGAAATC) and β-actin (Forward: CACTTTCTACAATGAGCTGCG, Reverse: CTGGATGGCTACGTACATGG). The comparative threshold cycle values were normalized for the β-actin reference gene and the results were expressed as CT relative quantification by the 2-ΔΔCT method.
Stratagene mx3000p
Manufactured by Thermo Fisher Scientific
Sourced in United States
The Stratagene MX3000P is a real-time PCR system designed for quantitative gene expression analysis. It features a 96-well format and utilizes a camera-based detection system to monitor fluorescence signals during thermal cycling.
Automatically generated - may contain errors
Lab products found in correlation
Kapa sybr fast qpcr, by Roche (2 mentions)
Trizol, by Merck Group (2 mentions)
Perfecta sybr green fastmix, by Thermo Fisher Scientific (1 mentions)
Spinsmart rna mini purification kit, by Thomas Scientific (1 mentions)
High capacity rna cdna kit, by Thermo Fisher Scientific (1 mentions)
Sybr green pcr mix, by Agilent Technologies (1 mentions)
Tri reagent, by Molecular Research Center (1 mentions)
Taqman snp genotyping assay 20x, by Thermo Fisher Scientific (1 mentions)
Nanodrop 2000 2000c spectrophotometer, by Thermo Fisher Scientific (1 mentions)
Ez press rna purification kit, by EZBioscience (1 mentions)
Reverse transcription master mix, by EZBioscience (1 mentions)
Sybr green qpcr master mix, by EZBioscience (1 mentions)
Trizol reagent, by Thermo Fisher Scientific (1 mentions)
7 protocols using stratagene mx3000p
1
Quantifying BcL-2 Expression in PC-12 Cells
2
Quantitative PCR Analysis of Gene Expression
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA was isolated by using SpinSmart RNA Mini Purification Kit (Denville Scientific Inc., Metuchen, NJ, https://www.denvillescientific.com ). One microgram of RNA was reverse transcribed by using a High Capacity RNA‐cDNA kit (Thermo Fisher). Real‐time quantitative PCR was performed by using Perfecta SYBR Green FastMix on a Stratagene MX3000P (Thermo Fisher).
The following primers were used: COL1‐FOR primer 5′CTG CTG GCA AAG ATG GAG A3′ and COL1‐REV primer 5′ACC AGG AAG ACC CTG GAA TC3′; COL3‐FOR primer 5′ CAA ATG GCA TCC CAG GAG3′ and COL3‐REV primer 5′CAT CTC GGC CAG GTT CTC 3′; α‐SMA‐FOR primer 5′AGC GTG AGA TTG TCC GTG ACA T3′ and α‐SMA‐REV primer 5′ GCG TTC GTT TCC AAT GGT GA3′; VE‐cadherin‐FOR primer 5′ACC ATC GCC AAA AGA GAG AC3′ and VE‐cadherin‐REV primer 5′TCT TGC CAG CAA ACT CTC CT3′; CD31‐FOR primer 5′AGC GCA GTC TTA CCG AAG G3′; CD31‐REV primer 5′TCT TGC CAG CAA ACT CTC CT3′; Oct4–FOR primer CAAGGCAAGGGAGGTAGACA; REV primer GCTCCTGATCAACAGCATCA; KLF4 – FOR primer CCAGCAAGTCAGCTTGTGAA; REV primer GGGCATGTTCAAGTTGGATT; c‐Myc – FOR primer GCCTAACCTCACAACCTTGG; REV primer CCTATTTACATGGGAAAATTGGA; Nanog – FOR primer AGCCTCCAGCAGATGCAAGA; and REV primer GCACTTCATCCTTTGGTTTTGA. Values were normalized for the abundance of the amplified 18s rRNA in each experiment. Fold change in gene expression was determined by using the 2‐ΔΔCT method.
The following primers were used: COL1‐FOR primer 5′CTG CTG GCA AAG ATG GAG A3′ and COL1‐REV primer 5′ACC AGG AAG ACC CTG GAA TC3′; COL3‐FOR primer 5′ CAA ATG GCA TCC CAG GAG3′ and COL3‐REV primer 5′CAT CTC GGC CAG GTT CTC 3′; α‐SMA‐FOR primer 5′AGC GTG AGA TTG TCC GTG ACA T3′ and α‐SMA‐REV primer 5′ GCG TTC GTT TCC AAT GGT GA3′; VE‐cadherin‐FOR primer 5′ACC ATC GCC AAA AGA GAG AC3′ and VE‐cadherin‐REV primer 5′TCT TGC CAG CAA ACT CTC CT3′; CD31‐FOR primer 5′AGC GCA GTC TTA CCG AAG G3′; CD31‐REV primer 5′TCT TGC CAG CAA ACT CTC CT3′; Oct4–FOR primer CAAGGCAAGGGAGGTAGACA; REV primer GCTCCTGATCAACAGCATCA; KLF4 – FOR primer CCAGCAAGTCAGCTTGTGAA; REV primer GGGCATGTTCAAGTTGGATT; c‐Myc – FOR primer GCCTAACCTCACAACCTTGG; REV primer CCTATTTACATGGGAAAATTGGA; Nanog – FOR primer AGCCTCCAGCAGATGCAAGA; and REV primer GCACTTCATCCTTTGGTTTTGA. Values were normalized for the abundance of the amplified 18s rRNA in each experiment. Fold change in gene expression was determined by using the 2‐ΔΔCT method.
3
RNA Isolation and qRT-PCR Analysis
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA was isolated from mouse epithelial crypt cells or cultured cell lines with Tri-Reagent (Molecular Research Center, Cincinnati, OH) according to manufacturer’s instructions. After rDNase digestion (Macherey-Nagel, Hoerdt, France), RNA integrity was checked by gel electrophoresis. Reverse transcription (RT) was performed with 1 μg of RNA using Roche reagents (Roche Diagnostics). Real-time PCR was conducted with cDNA and both the sense and antisense oligonucleotides in a volume of 10 μl of SYBR green PCR mix (Agilent, Massy, France) and monitored and assessed in a Stratagene Mx3000P (Thermo Fisher Scientific) system. Values were normalized to L19 or 18S for human cells or to cyclophilin expression for mouse cells. Primer sequences are given in Supplemental Table S3.
4
Quantification of BCL2 Gene Expression
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA was purified using TRIZOL (Sigma, USA), and the reaction was performed with the commercial kit KAPASYBR FAST qPCR (KapaBiosystems, USA) and the equipment for Stratagene MX3000P (ThermoFisher, USA) real-time PCR. The qPCR was performed using RNA as template, the primers were ordered from Integrated DNA Technologies (Coralville, USA): BCL2 (Forward: GATGACTGAGTACCTGAACCG, Reverse: CAGAGACAGCCAGGAGAAATC) and β-actin (Forward: CACTTTCTACAATGAGCTGCG, Reverse: CTGGATGGCTACGTACATGG). The comparative threshold cycles values were normalized for β-actin reference gene and the results were expressed as CT relative quantification by 2-ΔΔCT method [43] (link).
5
MTNR1A Genotyping Protocol for Whole Blood
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Genomic DNA was extracted from whole blood samples using GeneJET whole blood Genomic DNA Mini Kit (Thermo Fisher Scientific, USA) according to the manufacturer's instructions. DNA's purity and concentration were measured using Nanodrop 2000/2000c spectrophotometer (Thermoscientific, USA).
Genotyping for MTNR1A polymorphism (rs13140012) was performed using the 5'nuclease allelic discrimination assay. The PCR reaction mix included 10 μLTaqMan® Universal PCR Master Mix (Thermo Fisher Scientific, USA), 1 μL of TaqMan® SNP Genotyping Assay 20x (Assay ID: C__31861431_10), 20 ng DNA/reaction and DNAase free water to a final volume of 20 μL. Thermal cycling was done using Stratagene Mx3000P (Thermo Fisher Scientific, USA) as follows; 95 °C for 10 min for initial AmpliTaq Gold enzyme activation and 45 cycles of denaturation for 15 s at 95 °C and annealing/extension for 1 min at 60 °C. No template control (NTC) containing nuclease-free water was included in each run as a negative control. The fluorescence profile of each well was detected at the end of each cycle, and a graphic presentation of the fluorescence against the number of cycles was plotted. Data processing was performed using Stratagene Mx3000PTM Software (MX.PRO software).
Genotyping for MTNR1A polymorphism (rs13140012) was performed using the 5'nuclease allelic discrimination assay. The PCR reaction mix included 10 μLTaqMan® Universal PCR Master Mix (Thermo Fisher Scientific, USA), 1 μL of TaqMan® SNP Genotyping Assay 20x (Assay ID: C__31861431_10), 20 ng DNA/reaction and DNAase free water to a final volume of 20 μL. Thermal cycling was done using Stratagene Mx3000P (Thermo Fisher Scientific, USA) as follows; 95 °C for 10 min for initial AmpliTaq Gold enzyme activation and 45 cycles of denaturation for 15 s at 95 °C and annealing/extension for 1 min at 60 °C. No template control (NTC) containing nuclease-free water was included in each run as a negative control. The fluorescence profile of each well was detected at the end of each cycle, and a graphic presentation of the fluorescence against the number of cycles was plotted. Data processing was performed using Stratagene Mx3000PTM Software (MX.PRO software).
6
Validation of mRNA and lncRNA Expression
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The expression levels of mRNAs and lncRNAs were validated by RT-qPCR. Total RNA was extracted from the keloid tissue and adjacent normal skin tissues of other five randomly selected keloid patients using EZ-press RNA Purification Kit (EZBioscience, USA). A 4×Reverse Transcription Master Mix (EZBioscience) was used for reverse transcription reaction at 42°C for 15 min, 95°C for 3 min. The 2×SYBR Green qPCR Master Mix (EZBioscience) was used to perform qPCR as follows: initial denaturation at 95°C for 5 min, followed by 40 amplification cycles (10s at 95°C for denaturation, and 30s at 60°C for annealing and extension) using a Strata Gene Mx3000p (Applied Biosystems). Each interested gene was normalized to the housekeeping gene GAPDH and the fold change was compared relatively to that of the control sample. qPCR assay was performed in triplicate and repeated at least three times.
7
Quantitative RNA Expression Analysis of Scar Tissue
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
RNA was isolated from the scar tissue on postoperative day 30 and day 60 using a Trizol Reagent (Invitrogen, Carlsbad, California) with the help of a rotor‐stator homogeniser. Amount of 2 μg total RNA, 4 mL 5 × buffer, 2 mL dNTP, 1 mL oligo‐(dT), 0.5 mL AMV reverse transcriptase, 0.5 mL RNase inhibitor, and DDW was filled up to the total volume of 20 mL mixture. The cDNA was reversely transcribed by cultivating at 30°C for 10 minutes, 45°C for 60 minutes, 95°C for 5 minutes, and 5°C for 5 minutes. Then cDNA was amplified using a Strata Gene Mx3000p (Applied Biosystems). qPCR conditions were set as follows: initial denaturation at 95°C for 10 minutes, followed by 40 cycles at 95°C for 30 seconds, 58°C for 30 s, and 72°C for 45 seconds. Each interested gene was normalised to the housekeeping gene GAPDH and the fold change was compared relative to the control sample. The designed primers were listed in Table 1 . qPCR assay was repeated at last three times.
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!