Rnaeasy plus

RT reactions were performed on total RNAs (1μg), purified using RNA-easy Plus, as described by the manufacturer (Qiagen), using the Moloney Murine Leukemia virus RT kit, as detailed by the manufacturer (LifeTechnologies, Inc, Paisley, UK). RT reactions were subjected to PCR using the following primers: GAPDH: 5′-AGGTCCACCACTGACAGTT-3′ (forward) and 5′-CTGCACCACCAACTGCTT AG-3′ (reverse); CHOP: 5′-ACCAAGGGAGAACCAGGAAACG-3′ (forward) and 5′-TCACCATTCGGTCAAT CAGGC-3′ (reverse); XBP1: 5′-TTACGAGAGAAAACTCATGGC-3′ (forward) and 5′-CGGTCCAAGTTGTCCAGA ATGC-3′ (reverse).

Total RNA from each cell line was harvested using RNAeasy Plus (Qiagen). 10 μg of total RNA was reverse-transcribed and cDNA synthesized using random hexamer priming (Transcriptor cDNA synthesis, Roche). FastStart Universal SYBR Green 2X Master Mix (Roche) was used to perform quantitative PCR for hCa_V3.3 (CACNA1I: 5′CAATGGACTGGATGCTGTTG/5′ATCCAGGGGTTGTGGTTG) and β-actin (ACTB: 5′CCAACCGCGAGAAGATGA/5′CCAGAGGCGTACAGGGATAG). CACNA1I mRNA in each cell line was analyzed by the relative quantitation of gene expression method and using ACTB that encodes β-actin as the reference control gene (ΔΔCt method)33 (link). Threshold amplification cycle (CT) values were obtained for target (CACNA1I) and internal control (ACTB) to calculate ∆CT (CT target–CT reference), and ΔΔCt calculated before and after induction of CACNA1I by doxycycline treatment. We carried out 3–4 technical replicates, from three independent cell culture and dox-induction step (biological triplicates). The biological variability in our RT-qPCR experiments stems primarily from different overall levels of mRNA induction across biological replicates.

Isolation, purification, amplification and sequencing of all the genomic DNA, RNA and cDNA fragments from D. discoideum Ax2, mutant strains and plasmids was done as previously described [48] (link). Plasmids and competent cells were obtained from Life Technologies, (Carslbad CA, USA) [48] (link). For RNA, recombinant RNasin Ribonuclease (Promega, Madison, WI, USA) was added to inhibit RNA degradation. RNA was additionally purified from residual genomic DNA by using RNAeasyPlus (Qiagen, Ventura, CA, USA) according to the manufacturer's instructions. The primers used in this study are listed in a Table S1. Transformants were generated as described [48] (link) and selected for using either 10 µg/ml Blasticidin S (Enzo Life Science, Farmingdale, NY, USA) and/or 20–70 µg/ml G418 (Sigma-Aldrich, St.Louis, USA). For clonal growth selection of the ptenA⁻/lpten^oe and lpten⁻/lpten^oe strains, cells were sorted by FACS as described [48] (link).