Agilent bioanalyzer high sensitivity assay

ATAC-Seq was performed following the protocol described by Buenrostro and colleagues [40 ]. Propagation and embryoid body (EB)-based differentiation of the doxycycline-inducible Pax3 ES cell line was performed as previously described [41 ]. Pax3 induction was achieved by adding doxycycline (final concentration of 1 μg/ml) in 3-day EB cultures. Fifty thousand freshly sorted PDGFRa+FLK1− cells from cultures differentiated for 4 days (non-induced and 1-day Pax3-induced cells) were washed with 200 μl of cold PBS then resuspended in 100 μl of cold lysis buffer (10 mM Tris-HCl pH 7.4, 10 mM NaCl, 3 mM MgCl₂, 0.1% IGEPAL CA-630), spun at 500 g for 10 min at 4 °C, and resuspended in 50 μl of the transposition reaction mix. Transposition occurred at 37 °C for 30 min, after which transposed DNA was purified using a Qiagen MinElute Kit and eluted in 12 μl Elution Buffer. Transposed DNA was quantified using qPCR, followed by the final PCR amplification using Illumina-compatible adapter-barcodes (using the forward indexing primers and reverse indexing primers described above). Three independent libraries were generated for both non-induced and Pax3-induced cells. Libraries were quantified using a Qubit dsDNA broad-range assay (Thermo Fisher Scientific), fragment sizes were assessed using an Agilent Bioanalyzer High Sensitivity assay, and libraries were normalized to 2 nM for sequencing.

The following PCR reactions were set up to amplify the BC constructs: 1 μl DNA (1 ng/μl), 5 μl 10× Qiagen PCR buffer, 2 μl MgCl₂ (25 mM), 2.5 μl DMSO, 0.4 μl dNTPs (25 mM), 0.25 μl Qiagen Taq (5 U/μl), 2.5 μl primer 1 (10 μM), 2.5 μl primer 2 (10 μM), and 33.85 μl nuclease-free water.
The following primers were used to amplify the BC constructs: p5: AATGATACGGCGACCACCGA and p7: CAAGCAGAAGACGGCATACGA.
Samples were amplified using the following cycling conditions: 95 °C for 5 min, followed by 10, 20, 30, or 40 cycles of 94 °C for 30 s, 55 °C for 30 s, and 72 °C for 30 s, followed by incubation at 72 °C for 10 min. Libraries were quantified using a Quant-iT PicoGreen dsDNA assay (Thermo Fisher Scientific), fragment sizes were assessed using an Agilent Bioanalyzer High Sensitivity assay, and libraries were normalized to 2 nM for sequencing.

Universal Human Reference RNA (Agilent, Catalog number: 740000–41) was processed using a Truseq Stranded mRNA Sample Preparation Kit (Illumina). Briefly, 1 μg of total RNA was oligo-dT purified using oligo-dT-coated magnetic beads, fragmented, and then reverse transcribed into cDNA. The cDNA was adenylated and then ligated to dual-indexed (barcoded) adaptors using TruSeq RNA CD Indices (Illumina) and amplified using 15 cycles of PCR according to the Truseq Stranded mRNA Sample Preparation Kit protocol. The library was quantified using a Quant-iT PicoGreen dsDNA assay (Thermo Fisher Scientific), fragment sizes were assessed using an Agilent Bioanalyzer High Sensitivity assay, and libraries were normalized to 2 nM for sequencing.

Total RNA-Seq library construction and sequencing were performed at Exosome Diagnostics (Waltham, MA) using the proprietary EV long RNA-Seq platform. Briefly, isolated RNA samples from whole blood, plasma, CSF, and urine were first treated with DNase to remove any trace amounts of co-purified DNA present in the sample. Post-DNA digestion, synthetic RNA spike-in controls (ERCC spike-in mix, Thermo Fisher Scientific) were added to each sample. The exoRNA/ERCC blend was then reverse transcribed using a combination of random hexamers and oligo-dT primers. Second strand synthesis and adapter addition were performed using a PCR-based approach. Libraries were purified via two rounds of AMPureXP^® beads (Beckman Coulter), and ribosomal cDNA was depleted enzymatically. The final libraries were then amplified to desired concentration for sequencing and purified using AMPureXP^®. Libraries were quantified using the Agilent Bioanalyzer^™ High Sensitivity Assay (Agilent Technologies, Santa Clara, CA, USA) and Qubit 1X dsDNA HS Assay Kit (Thermo Fisher Scientific, Waltham, MA, USA). Libraries were pooled and sequenced on Illumina^® NextSeq500 using 2 × 150 cycles read length chemistry.

The single cell suspension was loaded onto a well on a 10x Chromium Single Cell instrument (10x Genomics). Barcoding and cDNA synthesis were performed according to the manufacturer’s instructions. Briefly, the 10x GemCode Technology partitions thousands of cells into nanoliter-scale Gel Bead-In-EMulsions (GEMs), where all the cDNA generated from an individual cell share a common 10x Barcode. In order to identify the PCR duplicates, Unique Molecular Identifier (UMI) was also added. The GEMs were incubated with enzymes to produce full length cDNA, which was then amplified by PCR to generate enough quantity for library construction. Quality was checked using the Agilent Bioanalyzer High Sensitivity Assay.