The largest database of trusted experimental protocols

27 protocols using toluene

1

Fabrication of Serotonin Aptamer Biosensor

Check if the same lab product or an alternative is used in the 5 most similar protocols
3,4-Ethylenedioxythiophene (EDOT), polyacrylonitrile (PAN), dimethylformamide (DMF), ferric chloride, 4-(4,6-dimethoxy-1,3,5-triazin-2-yl)-4-methylmorpholinium chloride (DMTMM), hexamethyldisilazane (HMDS), 3,4-Dimethoxythiophene, p-toluenesulfonic acid monohydrate (pTsOH·H2O), butylated hydroxytoluene (BHT), tetrahydrofuran (THF), and Sylgard 184 polydimethylsiloxane (PDMS) were obtained from Sigma–Aldrich. Ethanol, toluene, mEthanol, hexane (Hex), hydrochloric acid (HCl), and ethyl acetate (EtOAc) were obtained from Samchun. Sodium hydroxide (NaOH) was purchased from Daejung. (S)-Methyl 2,3-dihydroxypropanoate (Methyl glycerate) was purchased from Combi-Block. AZ5214E was obtained from Clariant. A serotonin aptamer with the sequence 5′-CGACTGGTAGGCAGAT AGGGGAAGCTGATTCGAGCGTGGGTCG[C6 Amine]-3′ was synthesized by Bioneer. Phosphate buffered saline (PBS) pH 7.4 (1 ×) was purchased from Gibco™, and simulated blood serum and artificial CSF were purchased from Biochemazone. All reagents and solvents were used as received without further treatment.
+ Open protocol
+ Expand
2

Synthesis of Conjugated Polymers

Check if the same lab product or an alternative is used in the 5 most similar protocols
Sodium, FeCl3, 2-methyl-2-butanol, 2-ethyl hexyl bromide, Pd(PPh3)4, CuI, (i-Pr)2NH, ethynyltrimethylsilane, N-bromosuccinimide, 3,4-ethylenedioxythiophene, and 2,5-dibromothiophene were purchased from Sigma-Aldrich. DMF and 2-carbonitrile thiophene were purchased from Alfa Aesar Co. Tetrahydrofuran, dichloromethane, toluene, methanol, ethyl acetate, hexane, CHCl3, and potassium carbonate were purchased from Samchun Pure Chemicals. Tetrahydrofuran (THF), diethyl ether, toluene, and methylene chloride were used after distillation in the presence of Sodium/benzophenone or calcium hydride under nitrogen gas.
+ Open protocol
+ Expand
3

Flexible Organic Electrode Encapsulation

Check if the same lab product or an alternative is used in the 5 most similar protocols
Polystyrene‐block‐poly(isobutylene)‐block‐polystyrene (SiBS) (SIBSTAR 103T, Kaneka, Japan) was dissolved in toluene (Samchun, Korea) (15 wt% solution). PDMS (10:1, SYLGARD 184, Dow chemical) was spin‐coated and thermally cured at 130 °C for 1.5 h. SiBS solution was spin‐coated on a PDMS film (100 µm). The thickness of the SiBS film was 30 µm. An electrospun nanofiber mat (100 µm in thickness) made of polystyrene‐block‐poly(ethylene‐ran‐butylene)‐block‐polystyrene grafted with maleic anhydride (SEBS‐g‐MA, Sigma Aldrich) was covered on the SiBS/PDMS substrate and heat‐treated on the hot plate (80 °C, 2 h). Au was sputtered (20 mW, 400 s) on the SEBS‐g‐MA nanofiber mat through a patterned PET mask. The gel bilayer was transferred onto the SiBS/PDMS encapsulation film. The gel bilayer on the SiBS/PDMS film was covered with another PDMS/SiBS film and sealed by ironing at 140 °C.
+ Open protocol
+ Expand
4

Synthesis of Lead Bromide Perovskite Nanocrystals

Check if the same lab product or an alternative is used in the 5 most similar protocols
Lead bromide (PbBr2, 99.99 %, Sigma-Aldrich), cesium carbonate (Cs2CO3, 99.99 %, Sigma-Aldrich), 1-octadecene (ODE, 90 %, Sigma-Aldrich), oleic acid (OA, 90 %, Sigma-Aldrich), oleylamine (OLm, 80–90 %, Sigma-Aldrich), poly (maleic anhydride-alt-1-octadecene) (PMA) (99.99 %, Sigma-Aldrich, molecular weight = 30,000−50,000), n-hexane (95.0 %, Samchun), and toluene (99.99 %, Samchun) were purchased and used without further purification.
+ Open protocol
+ Expand
5

Breast Cancer Cell Cytotoxicity Assay

Check if the same lab product or an alternative is used in the 5 most similar protocols
TEOS, CTAB, dimethyl sulfoxide (DMSO), 3-(4,5-dimethylthoazol-2yl)-2,5-diphenyl-2H-tetrazolium bromide (MTT), carbamazepine, and high-performance liquid chromatography (HPLC) grade acetonitrile (ACN) were purchased from Sigma Aldrich (St. Louis, MO, USA). Ethanol, toluene, NaOH, hydrochloric acid (HCl, 36–38 v/v%), and formic acid (>99.0%) were purchased from Samchun Pure Chemical (Pyungtaek, Korea). Human breast cancer cell (MCF-7) line was obtained from Korean cell line bank (Seoul, Korea). Dulbecco’s modified Eagle’s medium (DMEM), fetal bovine serum (FBS), penicillin–streptomycin, and trypsin–EDTA were purchased from Gibco® BRL (Gaithersburg, MD, USA). DOX was provided as a gift from Korea United Pharm Inc. (Seoul, Korea).
+ Open protocol
+ Expand
6

Synthesis of Heterocyclic Compounds using Transition Metal Complexes

Check if the same lab product or an alternative is used in the 5 most similar protocols
The 4-methoxybenzoic acid, pyridine-2,6-dicarbaldehyde, phosphorous oxychloride, carbohydrazide, isocyanate and isothiocyanates, Hydrazine hydrate (80%), TEA, CS2, KOH, sodium hydrogen carbonate, and glacial acetic acid were purchased from Sigma-Aldrich, Darmstadt, Germany. The chloride salts of the transition metals were obtained from Aldrich and Alfa Aesar. Ethanol, mEthanol, chloroform, deionized water, acetonitrile, dimethyl sulfoxide, petroleum ether, ethyl acetate, n-hexane, toluene (Samchun Chemicals, Seoul, Korea), H2SO4, acetic acid, and HCl (Jin Chemical and Pharmaceutical Co. Ltd., Seoul, Korea) were used in this experiment. Urease from jack bean (EC 3.5.1.5), Thio-urea, sodium nitroprusside, and active chloride were purchased from Sigma (St. Louis, MO, USA). Stock solutions of the reducing substrates were prepared in phosphate buffer (20 mM, pH 6.8).
+ Open protocol
+ Expand
7

Preparation of Polymer Composite Materials

Check if the same lab product or an alternative is used in the 5 most similar protocols
Na2S∙5H2O and methyl alcohol were purchased from Daejung Chemicals (Siheung, Korea). 1,4-Dichlorobenzene was purchased from Kanto Chemicals (Tokyo, Japan). Sulfur (S8, powder, 98.0%) and toluene (99.5%) were purchased from Samchun Chemicals (Seoul, Korea). Lithium chloride, sodium acetate, and N-methyl-2-pyrrolidone (anhydrous, 99.5%) were purchased from Sigma-Aldrich. GO was obtained from Grapheneall Co., Ltd. (Hwaseong, Korea). The commercial PPS was provided by SK Chemical Co., Ltd. (Seoul, Korea).
+ Open protocol
+ Expand
8

Graphite-Based Thermal Conductive Adhesive Synthesis

Check if the same lab product or an alternative is used in the 5 most similar protocols
Butyl acrylate (>99%), 2-ethylhexyl acrylate (>99%), ethyl acrylate (>99%), 2-hydroxyethyl acrylate (>95%), acrylic acid (>99%), abietic acid (>80%), triethylamine (>99%), and 2-isocyanatoethyl methacrylate (>98%) were purchased from Tokyo Chemical Industry. Tris(4-hydroxyphenyl)methane triglycidyl ether (>95%) and dibutyltin dilaurate (95%) were purchased from Sigma-Aldrich Korea Ltd. (Yongin, Korea). Toluene (99.5%), ethyl acetate (99.5%), and methyl ethyl ketone (99.5%) were purchased from Samchun Chemical (Pyeongtaek, Korea). Azobisisobutyronitrile (AIBN, 98%) was purchased from Junsei Chemical (Tokyo, Japan). All chemicals were used as received without further purification. The epoxy crosslinker was used after dilution to a solid content of 5 wt% with Toluene. A 17-μm-thick graphite sheet was purchased from Tanyuan technology (Changzhou, China). A silicone-coated polyethylene terephthalate (PET) film and a polyethylene terephthalate (PET) film were purchased from SKC (Seoul, Korea). A stainless steel (SS) plate was purchased from MMSTECH (Bucheon, Korea). The micro structure of the g-TC film was analyzed using a scanning electron microscope (SEM, JSM 6380, JEOL, Tokyo, Japan) and a digital microscope (MXB-5000REZ, HIROX, Tokyo, Japan).
+ Open protocol
+ Expand
9

Synthesis of Metal Nanoparticles

Check if the same lab product or an alternative is used in the 5 most similar protocols
Ethylene glycol, ethanol, and toluene were purchased from Samchun Chemicals (Republic of Korea). Poly(styrene-ethylene-butylene-styrene) (SEBS (H1041)) elastomer was obtained from Asahi Kasei (Japan). Silver nitrate, copper (II) chloride, poly(vinylpyrrolidone) (PVP, Mw, ~ 40 k and ~ 1,300 k), 1-Propanethiol, and 3-Mercapto-1-propanol were purchased from Sigma Aldrich (USA).
+ Open protocol
+ Expand
10

Epoxy-Functionalized Silane Synthesis

Check if the same lab product or an alternative is used in the 5 most similar protocols
2-(3,4-Epoxycyclohexyl)ethyltrimethoxysilane (ECTMS, 97%) was purchased from Gelest (Philadelphia, PA, USA). Tetramethylammonium hydroxide (TMAH, 10 wt% in water) was purchased from TCI (Tokyo, Japan). Isopropyl alcohol (IPA, 99.9%), toluene, tetrahydrofuran (THF, 99.9%), chloroform (99.8%), and water were purchased from Samchun (Seoul, Korea). All organic solvents were HPLC grade. Potassium carbonate (PC, 99%) was purchased from Sigma-Aldrich (St. Louis, MO, USA). Irgacure 250 (photoinitiator) was purchased from Shinyoung Rad Chem (Seoul, Korea).
+ Open protocol
+ Expand

About PubCompare

Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.

We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.

However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.

Ready to get started?

Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required

Sign up now

Revolutionizing how scientists
search and build protocols!