Log In Sign up
The largest database of trusted experimental protocols

Hs06879643 cn

Manufactured by Thermo Fisher Scientific
Visit Supplier

The Hs06879643_cn is a lab equipment product from Thermo Fisher Scientific. It is designed for laboratory applications and has a core function of [core function]. Further details on the intended use of this product are not available.

Automatically generated - may contain errors

Lab products found in correlation

Droplet digital pcr, by Bio-Rad (2 mentions) Hs03587795 cn, by Thermo Fisher Scientific (2 mentions)

2 protocols using hs06879643 cn

1

Detecting and Validating Copy Number Variations

Cited 2 times
Check if the same lab product or an alternative is used in the 5 most similar protocols
CNVs were detected using Birdsuite (version 1.6)31 (link). Events with LOD score >/= 10 kb and size >/= 10kb were lifted onto HG19 using the UCSC browser’s lift over tool. These spanned ~16 loci. One of these events (HG19:chr6:78973201-79029367) overlaps a region of common CNVs in HapMap32 (link). CNVs were validated with either commercially available or custom designed TaqMan probes. Probes were - 6p22.1, HG19:chr6:29859709-29896421, Hs03587795_cn (LifeTech), context sequence CAGGAGAATGTTCCTGCTGAGGACA; Chr9,HG19:chr9:7734481-7770942, Hs06879643_cn, context sequence AATAGCCTCATTACACCTTGCAAAT; 6q16.1, HG19:chr6:95486777-95578465, probe primer TCCATAATCAGCGTGGCATA, 5’ 6-FAM ZEN 3’Iowa Black FQ, forward primer TCAGGGTTGGTTTGCTTATTG, reverse primer CACCAATATATGTTCAAAGGGTCA. Assays were carried out using digital droplet PCR (Bio-Rad) according to the manufacturer’s instructions.
Madison J.M., Zhou F., Nigam A., Hussain A., Barker D.D., Nehme R., van der Ven K., Hsu J., Wolf P., Fleishman M., O’Dushlaine C., Rose S., Chambert K., Lau F.H., Ahfeldt T., Rueckert E.H., Sheridan S.D., Fass D.M., Nemesh J., Mullen T.E., Daheron L., McCarroll S., Sklar P., Perlis R.H, & Haggarty S.J. (2015). Characterization of Bipolar Disorder Patient-Specific Induced Pluripotent Stem Cells from a Family Reveals Neurodevelopmental and mRNA Expression Abnormalities. Molecular psychiatry, 20(6), 703-717.
+ Open protocol
+ Expand
2

Detecting and Validating Copy Number Variations

Cited 2 times
Check if the same lab product or an alternative is used in the 5 most similar protocols
CNVs were detected using Birdsuite (version 1.6)31 (link). Events with LOD score >/= 10 kb and size >/= 10kb were lifted onto HG19 using the UCSC browser’s lift over tool. These spanned ~16 loci. One of these events (HG19:chr6:78973201-79029367) overlaps a region of common CNVs in HapMap32 (link). CNVs were validated with either commercially available or custom designed TaqMan probes. Probes were - 6p22.1, HG19:chr6:29859709-29896421, Hs03587795_cn (LifeTech), context sequence CAGGAGAATGTTCCTGCTGAGGACA; Chr9,HG19:chr9:7734481-7770942, Hs06879643_cn, context sequence AATAGCCTCATTACACCTTGCAAAT; 6q16.1, HG19:chr6:95486777-95578465, probe primer TCCATAATCAGCGTGGCATA, 5’ 6-FAM ZEN 3’Iowa Black FQ, forward primer TCAGGGTTGGTTTGCTTATTG, reverse primer CACCAATATATGTTCAAAGGGTCA. Assays were carried out using digital droplet PCR (Bio-Rad) according to the manufacturer’s instructions.
Madison J.M., Zhou F., Nigam A., Hussain A., Barker D.D., Nehme R., van der Ven K., Hsu J., Wolf P., Fleishman M., O’Dushlaine C., Rose S., Chambert K., Lau F.H., Ahfeldt T., Rueckert E.H., Sheridan S.D., Fass D.M., Nemesh J., Mullen T.E., Daheron L., McCarroll S., Sklar P., Perlis R.H, & Haggarty S.J. (2015). Characterization of Bipolar Disorder Patient-Specific Induced Pluripotent Stem Cells from a Family Reveals Neurodevelopmental and mRNA Expression Abnormalities. Molecular psychiatry, 20(6), 703-717.
+ Open protocol
+ Expand

About PubCompare

Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.

We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.

However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.

Ready to get started?

Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required

Sign up now

Revolutionizing how scientists
search and build protocols!