Cells were transfected using the Lipofectamine 3000 kit (#L3000015, Invitrogen/Thermo Fisher, Waltham, MA, USA) according to the manufacturer’s instructions. Briefly, the 661W cells were seeded at 30% confluency and allowed to grow for 24 h to reach 50% confluency. For Western blot and quantitative real-time RT-PCR (qPCR), the cells were seeded in 6-well plates and transfected with 30 pmol/well microRNA (miRNA)/small interfering RNA (siRNA). For terminal deoxynucleotidyl transferase dUTP nick end labeling (TUNEL) and immunofluorescent staining, the cells were seeded on 12 mm circular coverslips in 24-well plates and transfected with 10 pmol/well miRNA/siRNA. After the first exchange to normal culture medium, some cultures were immediately treated with PA or BSA for various hours. The following miRNAs/siRNAs were used in this study: miRNA negative control (#4464058, Thermo Fisher), miR-150 mimic (Assay MC10070, #4464066, Thermo Fisher), miR-150 inhibitor (Assay MH10070, #4464084, Thermo Fisher), siRNA negative control (#AM4613, Thermo Fisher), and Elk1 siRNA (Assay 261017, #AM16708, Thermo Fisher).
Am4613
Manufactured by Thermo Fisher Scientific
Sourced in United States
The AM4613 is a laboratory equipment product from Thermo Fisher Scientific. It is a compact instrument designed for precise and reliable centrifugation of various sample types. The core function of the AM4613 is to separate and concentrate materials within a liquid sample through the application of centrifugal force.
Automatically generated - may contain errors
Lab products found in correlation
Lipofectamine 3000 kit, by Thermo Fisher Scientific (2 mentions)
Am4611, by Thermo Fisher Scientific (2 mentions)
Am4615, by Thermo Fisher Scientific (2 mentions)
Am4641, by Thermo Fisher Scientific (2 mentions)
Lipofectamine rnaimax, by Thermo Fisher Scientific (1 mentions)
Am16708, by Thermo Fisher Scientific (1 mentions)
C 12533, by PromoCell (1 mentions)
6 protocols using am4613
1
Transfection and Treatment of 661W Cells
2
Lipofectamine-based Transfection for Cell Cultures
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Transfection was conducted using the Lipofectamine 3000 kit (#L3000015, Invitrogen/ThermoFisher) according to the manufacturer's instruction. Briefly, the 661W cells were seeded at 30% confluency and allowed to grow for 24 h to reach 50% confluency. For Western blot and qPCR, cells were seeded in 6‐well plates and transfected with 30 pmol/well microRNA (miRNA)/siRNA. For Terminal deoxynucleotidyl transferase dUTP nick end labelling (TUNEL) and immunofluorescent staining, the cells were seeded on 12 mm circular coverslips in 24‐well plates and transfected with 10 pmol/well miRNA/siRNA. After the first exchange to normal culture medium, some cultures were immediately treated with PA or BSA for various hours. The following miRNAs / siRNAs were used in this study: miRNA negative control (#4464058, ThermoFisher), miR‐150 mimic (Assay MC10070, #4464066, ThermoFisher), miR‐150 inhibitor (Assay MH10070, #4464084, ThermoFisher), siRNA‐negative control (#AM4613, ThermoFisher) and Elk1 siRNA (Assay 261017, #AM16708, ThermoFisher).
3
siRNA and shRNA Knockdown Techniques
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
siRNAs were used to transfect resting CD4 T cells. The control siRNA contains a pool of Silencer Negative siRNAs (Nos. 1–4, AM4611, AM4613, AM4615 and AM4641, Life Technologies). MINA53 siRNAs: siMINA53-1, 5′-GGG UCC CUG UUC AAG CUA A-3′; siMINA53-2, 5′-GAA CCA UUC AUC AAG CGG A-3′ (Life Technologies). Gene-specific or non-targeting (NT) shRNAs were cloned into pAPM or pInducer10 lentiviral vector as previously described (16 (link)), using XhoI and EcoRI sites. These lentviral vectors were packed into lentiviruses by co-transfection with psPAX2 and pMD2.G package vectors into HEK293T cells. pAPM lentiviruses were transduced into J-LAT A2, J-LAT 10.6 or U1/HIV cells, and pInducer10 lentiviruses into primary CD4 T cells, which were selected by puromycin. shRNA expression in pInducer10-transduced cells was induced by treating cells with doxycycline (0.1 μg/ml). Knockdown of shRNA-targeted genes was measured by qPCR or immunoblotting. The gene-specific shRNAs are listed: Non-targeting (NT)-sh: 5′cacaaacgctctcatcgacaag3′; KDM5A-sh: 5′cagcctctatttgcttgtgaa3′; KDM1B-sh: 5′gcaagcaagattgcagtattt3′; MINA53-sh: 5′attggctcgaatgtgtacata3′; KDM4A-sh: 5′gccttgggtctttctgtggat3′; UTY-sh: 5′gcgagcaaatagagataattt3′; KAT8-sh: 5′aaagacagtgaaggatgctgta3′.
4
RICTOR Knockdown in LMS Cells
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
For transfections, 1 × 105 LMS cells were seeded in duplicate into 6-well plates and grown to 60–70% confluency. Cells were transfected and incubated for 72 hours with 80 pmol RICTOR RNAi (AM16708-261571, Life Technologies, Carlsbad, CA, USA) using 6 μL Lipofectamine RNAiMAX (Invitrogen, Carlsbad, CA, USA) in a total volume of 300 μL growth medium containing 10% FBS. Then, protein samples were collected for western blotting. Each RNAi experiment was performed at least 2 times. Negative control (AM4613, Life Technologies, Carlsbad, CA, USA) using an RNAi that was not homologous to any known genes was used to control against nonspecific effects of the oligonucleotides.
5
MFAP4 Knockdown in Human Aortic SMCs
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Human aortic SMCs (PromoCell, C-12533, 3 different donors) were cultured on 6-well plates (1.5×105 cells/well) using SMC Growth Medium 2 (PromoCell C-22062) until 70% confluent. MFAP4 siRNA (50 nmol/L, Life Technologies, AM16708, Assay ID: 11386) and control siRNA (50 nmol/L, Life Technologies, AM4613) were transfected by using lipofectamine in different passages of different donors (2 for donor 1, 7 for donor 2, and 5 for donor 3) for 6 hours and subsequently in M199 with 100 U/mL penicillin, 100 µg/mL streptomycin, and 2.5% fetal bovine serum overnight. After replaced with complete medium (M199 with 100 U/mL penicillin, 100 µg/mL streptomycin, and 20% fetal bovine serum) and cultured for 48 hours, the cells were washed using M199 3 times, and further cultured in M199 for 24 hours. The cells were harvested for RNA extraction as detailed below. In total, 14 individual experiments using 3 different cell lines were performed for each condition. The experiment was repeated with a different MFAP4 siRNA at a lower concentration (25 nmol/L, Life Technologies, 4392420, Assay ID: s8716).
6
Interferon-Induced Protein 44 Knockdown
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!