Log In Sign up
The largest database of trusted experimental protocols

Rt2 primer assays

Manufactured by Qiagen
Visit Supplier

The RT2 Primer Assays are a collection of primer sets designed for real-time PCR analysis of gene expression. The assays target specific genes and facilitate accurate and reliable quantification of mRNA levels.

Automatically generated - may contain errors

Lab products found in correlation

Rt2 first strand kit, by Qiagen (3 mentions) Abi steponeplus cycler, by Thermo Fisher Scientific (1 mentions) Mastercycler realplex, by Eppendorf (1 mentions) Nanodrop 2000, by Thermo Fisher Scientific (1 mentions) 2xrt2 sybr green mastermix, by Qiagen (1 mentions) Rneasy mini kit, by Qiagen (1 mentions) Rnase free dnase set, by Qiagen (1 mentions)

3 protocols using rt2 primer assays

1

Quantitative PCR Analysis of DRG

Check if the same lab product or an alternative is used in the 5 most similar protocols
The extracted total RNA from the DRGs was reverse transcribed into cDNA using RT2 First Strand Kit (Qiagen, Germantown, MD) according to the manufacturer’s instructions. qPCR using pooled L4 and L5 DRG tissues from rats from the RNA sequencing study and additional rats were used. qPCR was performed using individual RT2 primer assays (Qiagen) on the ABI StepOnePlus cycler (Applied Biosystems, Waltham, MA) with RT2 SYBR green with ROX (Qiagen) according to manufacturer’s instructions. Each reaction was performed in triplicate and normalized to the housekeeping gene glyceraldehyde 3-phosphate dehydrogenase. Analysis was done using the Livak method35 (link) where fold change values were calculated compared to the naïve control group. A two-tailed Student’s t test, standard deviation, and error were calculated. A one-way ANOVA followed by post hoc testing and Tukey’s multiple comparison test with GraphPad Prism (version 8, San Diego, CA). A P value ≤ 0.05 was considered statistically significant in all analyses.
Stevens A.M., Saleem M., Deal B., Janjic J, & Pollock J.A. (2020). Targeted cyclooxygenase-2 inhibiting nanomedicine results in pain-relief and differential expression of the RNA transcriptome in the dorsal root ganglia of injured male rats. Molecular Pain, 16, 1744806920943309.
+ Open protocol
+ Expand
2

Glioma Stem Cell Differentiation

Check if the same lab product or an alternative is used in the 5 most similar protocols
100,000 primary glioma stem cells per well were seeded in a non-treated 24-well plate and grown in suspension over the first 24 h without any treatment. Subsequently, neurospheres were treated with a final A77 concentration of 500 nM or the equivalent volume of DMSO once per day for 5 days. Total RNA was isolated at day 1 and day 5 post-treatment using the Arcturus PicoPure RNA Isolation Kit (ThermoFisher), and RT-qPCR was performed on 700 ng of each RNA sample using the RT2 First Strand Kit and RT2 Primer Assays (Qiagen) for stemness markers NANOG, OCT4, and SOX2.
Zepecki J.P., Snyder K.M., Moreno M.M., Fajardo E., Fiser A., Ness J., Sarkar A., Toms S.A, & Tapinos N. (2018). Regulation of human glioma cell migration, tumor growth, and stemness gene expression using a Lck targeted inhibitor. Oncogene, 38(10), 1734-1750.
+ Open protocol
+ Expand
3

Quantifying POU5F1 Expression in Cells

Check if the same lab product or an alternative is used in the 5 most similar protocols
RNA was extracted from 3 × 106 cell pellets by RNeasy Mini Kit (Qiagen). The residues of DNA were wiped out by RNase-Free DNase Set (Qiagen). After quantification of RNA using Nanodrop 2000 (Fisher), RNA samples were processed to cDNA by RT2 First Strand Kit (Qiagen). qRT-PCR was performed with 2x RT2 SYBR Green Mastermix (Qiagen) and RT2 Primer Assays (Qiagen) on Eppendorf Mastercycler Realplex. The primers to detect POU5F1 and avoid pseudogenes (Forward sequence: GATGGCGTACTGTGGGCCC; Reverse sequence: TGGGACTCCTCCGGGTTTTG; Probe Sequence: CCAAGGCGGCTTGGAGACCT Fluorophore: FAM) is applied (Liedtke et al., 2007 (link)). The procedures followed the manufacturer’s instructions. No template control is set up as negative control. Cq values of the interested genes were determined and normalized by actin mRNA.
Piao J., Zabierowski S., Dubose B.N., Hill E.J., Navare M., Claros N., Rosen S., Ramnarine K., Horn C., Fredrickson C., Wong K., Safford B., Kriks S., El Maarouf A., Rutishauser U., Henchcliffe C., Wang Y., Riviere I., Mann S., Bermudez V., Irion S., Studer L., Tomishima M, & Tabar V. (2021). Preclinical Efficacy and Safety of a Human Embryonic Stem Cell-Derived Midbrain Dopamine Progenitor Product, MSK-DA01. Cell stem cell, 28(2), 217-229.e7.
+ Open protocol
+ Expand

About PubCompare

Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.

We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.

However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.

Ready to get started?

Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required

Sign up now

Revolutionizing how scientists
search and build protocols!