After performing reverse transcription, quantitative PCR analysis was performed both LightCycler 480 II (Roche, Basel, Switzerland) with FastStart Essential DNA Probes Master (Roche) as previously described (13 (link), 14 (link)) and CFX Opus Real-Time PCR Systems (Bio-Rad, Hercules, California, USA) with PrimePCR™ Probe Assay. Primer sequences for LightCycler 480 II were as follows: Arg1 sense, 5′-gaatctgcatgggcaacc-3′; Arg1 antisense, 5′-gaatcctggtacatctgggaac-3′; Chi3l3 sense, 5′-aagaacactgagctaaaaactctcct-3′; Chi3l3 antisense, 5′-gagaccatggcactgaacg-3′; Fizz1 sense, 5′-ccctccactgtaacgaagactc-3′; Fizz1 antisense, 5′-cacacccagtagcagtcatcc-3′; Il12p40 sense, 5′-ttgctggtgtctccactcat-3′; Il12p40 antisense, 5′-gggagtccagtccacctcta-3′; Tnfα sense, 5′-ctgtagcccacgtcgtagc-3′; Tnfα antisense, 5′-ttgagatccatgccgttg-3′; Actb sense, 5′-aaggccaaccgtgaaaagat-3′; Actb antisense, 5′-gtggtacgaccagaggcatac-3′. Unique assay ID of PrimePCR Probe (BioRad) for CFX Opus Real-Time PCR Systems were as follows: STAT3: qDreCIP0044562, Socs1: qMmuCEP0057945.
Lightcycler 480 2
Manufactured by Bio-Rad
Sourced in United States
The LightCycler 480 II is a real-time PCR instrument designed for quantitative gene expression analysis. It features a 96-well block format and supports a wide range of fluorescent detection chemistries.
Automatically generated - may contain errors
Lab products found in correlation
Iscript cdna synthesis kit, by Bio-Rad (2 mentions)
Primescript rt reagent kit with gdna eraser, by Takara Bio (2 mentions)
Nanodrop 2000 spectrophotometer, by Thermo Fisher Scientific (2 mentions)
Itaq universal sybr green supermix, by Bio-Rad (2 mentions)
Primepcr probe assay, by Bio-Rad (1 mentions)
Faststart essential dna probes master, by Roche (1 mentions)
Cfx opus real time pcr system, by Bio-Rad (1 mentions)
Lightcycler 480 2, by Roche (1 mentions)
Rneasy plus mini kit, by Bio-Rad (1 mentions)
Iq sybr green supermix, by Bio-Rad (1 mentions)
Power sybr green mix, by Thermo Fisher Scientific (1 mentions)
Rneasy mini kit, by Qiagen (1 mentions)
Sybr premix ex taq 2, by Takara Bio (1 mentions)
Trizol reagent, by Sangon (1 mentions)
Trizol reagent, by Thermo Fisher Scientific (1 mentions)
Trizol total rna extraction kit, by Tiangen Biotech (1 mentions)
7 protocols using lightcycler 480 2
1
Quantitative PCR Analysis Protocols
2
Quantification of bm4 Gene Expression
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
One-month-old midribs from plants homozygous for five of the bm4-Mu alleles, bm4-ref, and B73 (Table S2) were collected according to the method described above for RNA-Seq analysis. Single pools of 3–4 midribs from separate plants were prepared for each genotype. RNA was extracted from each pool using Qiagen's RNeasy Plus Mini kit and reversed transcribed with Bio-Rad's iScript cDNA Synthesis kit. Thus, one cDNA library was prepared for each genotype. Two technical replicates of each cDNA sample were run with bm4 gene-specific primers and two technical replicates of each cDNA sample were run with GAP primers. Quantitative real-time PCR was performed on a Roche Light Cycler 480II instrument using Bio-Rad's iQ SYBR Green Supermix. Relative expression for each sample was quantified using the 2−ΔΔCt method (Yuan et al., 2006 (link)). A single expression value was calculated for each genotype by averaging across all technical replicates. bm4 primers: (forward) bm4CE11L10.2 = 5′-TTGGCTAGTACGTGGCTTGA-3′ and (reverse) bm4C1E12R10.1 = 5′-GCGCTCCATCCAAATAAAAA-3′. GAP primers: (forward) gap987f = 5′-CTGAACGACCACTTCGTCAA-3′ and (reverse) gap1143r = 5′-TTCTCGGCATACACAAGCAG-3′.
3
Quantitative Real-Time PCR Analysis
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Expression levels were measured by quantitative Real-Time PCR. Total RNA was prepared with the RNeasy Mini Kit (Qiagen); 1 μg was used for first-stand cDNA synthesis with the iscript cDNA synthesis kit (BioRad). Real-time quantitative PCR was performed on a LightCycler 480II (BioRad) using the Power SYBR green mix (Applied Biosystems). Pimers used are listed in Table 2 .10.7554/eLife.01607.018
Sequences of primers used for RT-PCR
| Gene | Gene ID | Forward | Reverse |
|---|---|---|---|
| GAPDH1 | CG12055 | TTGTGGATCTTACCGTCCG | ACCTTAGCCTTGATTTCGTC |
| Arf79F | CG8385 | TTACAGTGTGGGATGTGGG | GAAGATAAGACCTTGTGTATTCTGG |
| βCOP | CG6223 | GACTTCTGCAATATCAAGGCC | GGTTTCGTAAACAATATTGCCG |
| CCT1 | CG1049 | GATACGGAGTGCGTCA | AATTCATCGGACAGAGTCCA |
4
Quantification of Gene Expression by RT-qPCR
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA was extracted from tissue samples and cells using Trizol reagent (Sangon Biotech, Shanghai, China) according to the manufacturer’s instructions. The qualities and concentrations of RNA samples were measured using NanoDrop 2000 spectrophotometer (ThermoFisher Scientific, MA, USA). Then, 1 μg of total RNA was used for the cDNA synthesis by use of PrimeScript RT reagent Kit with gDNA Eraser (TaKaRa, Dalian, China). All the cDNA solutions were diluted five-fold and stored at −20 °C for further use. The transcriptional level of genes was quantified by RT-qPCR with SYBR Premix ExTaq II (TaKaRa, Dalian, China) in a LightCycler 480 II real-time PCR system (BioRad, Shanghai, China). All gene expressions were normalized to the expression of BmRPL32 gene. The relative fold changes of gene expression were determined by the threshold cycle (2-△△CT) method [24 (link)]. All the primers used in this study are listed in Supplementary Table S1 .
5
Quantification of Specific RNA Levels
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA was isolated using TRIzol reagent (15596-018, Invitrogen). And 1 μg of total RNA was reverse-transcribed with PrimeScript™ RT reagent Kit with gDNA Eraser (RR047A, TaKaRa, Beijing, China). The levels of specific RNAs were measured using a Light Cycler 480II real-time PCR machine and the iTaq™ Universal SYBR Green Supermix (1725124, Bio-Rad, Hercules, CA, USA) according to the manufacturer instructions. All samples were assayed in triplicate. Data were normalized to a human Gapdh (glyceraldehyde-3-phosphate dehydrogenase) control. Relative quantitation was carried out by the comparative threshold cycle (CT) method. Statistical analysis was performed using the GraphPad Prism 8 software. The primer sequences are listed in supplementary Table 1 .
6
Total RNA Extraction and qRT-PCR Analysis
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Using the TRIzol Total RNA Extraction Kit (Tiangen Biotech Co., Ltd., Beijing, China) to extract total RNA. Using Fast King RT Kit (With gDNase) to form cDNA via reverse transcription. The qRT-PCR was performed on a LightCycler 480II uorescence quantitative PCR instrument with using iTaqTM Universal SYBR® Green Supermix (Bio-Rad Laboratories, Inc., Hercules CA, USA). The 2 - ΔΔCt method was employed to calculate the relative quantitation of key genes. Three separate biological replicates are required
7
Quantifying Moby 2.0 Plasmid Copy Numbers
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
We measured Moby 2.0 plasmid copy numbers in strains grown 10 generations in logphase as described above. Plasmid DNA was extracted from frozen cell pellets using phenol/chloroform and ethanol precipitation, which recovers both plasmid and genomic DNA. qPCR experiments were conducted using a Roche LightCycler 480 II and Roche LightCycler 480 SYBR Green I Master SYBR-Green (Bio-Rad, Hercules, CA). Primers were designed to detect the KAN-MX resistance gene located on plasmids and genomic TUB1 (control) (Table S3). CT values for each sample were measured in technical triplicate with all experiments done in ≥ 3 biological replicates. The CT values for KAN were internally normalized to TUB1 expressed from the genome and under extreme constraint on copy number. KAN/TUB1 ratios measured for each isolate carrying the 2micron plasmid were adjusted to BY4743 KAN/TUB1 ratios measured as an internal control in each experiment. Data were scaled to BY4743 values, which were adjusted relative to a KAN-MX marked CEN copy number measured in BY4743 (in the same way outlined above for Moby 2.0 plasmids).
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!