Rna clean up and concentration micro kit

Manufactured by Norgen Biotek

Sourced in Canada

The RNA clean-up and concentration micro kit is a laboratory tool designed to isolate and concentrate RNA samples. It facilitates the removal of contaminants and purification of RNA for further analysis or experimentation.

Automatically generated - may contain errors

Lab products found in correlation

Close spelling variants of this product

RNA Clean-Up and Concentration Kit (26 citations) RNA Clean-up and Concentration-Micro-Elute kit (3 citations) CleanAll DNA/RNA Clean-Up and Concentration Micro Kit (3 citations) Norgen RNA Clean-Up and Concentration Micro Kit (2 citations)

7 protocols using rna clean up and concentration micro kit

LARP1 RNA Immunoprecipitation and qPCR Analysis

Check if the same lab product or an alternative is used in the 5 most similar protocols

Cells were collected by trypsinization and re-suspended in RIP lysis buffer: 20 mM HEPES pH 7.4, 150 mM KCl, 5 mM MgCl2, 0.5% NP40, 400U/ml RNase inhibitor (Promega), 1 mM DTT, 400 μM VRC (NEB), protein (Roche) and phosphatase inhibitor (Calbiochem). Lysates were stored at −80°C overnight. RNA was immunoprecipitated with rabbit anti-LARP1 polyclonal antibody (SDIX-Novus Biologicals) or rabbit IgG isotype control (Cell Signalling Technology) following the method described by Keene et al. (26 (link)). RNA was extracted with Trizol (Life Technologies) and purified with the RNA clean-up and concentration micro kit (Norgen Biotek). To generate cDNA, immunoprecipitated RNA was reverse transcribed using the SensiScript^® RT Kit (Qiagen) following the manufacturer's instructions. RT-qPCR was performed as described earlier. The fold enrichment for each target was measured by comparing the Ct values of LARP1-immunoprecipitated fraction to the IgG isotype fraction and normalized using the ΔC_t formula.

Hopkins T.G., Mura M., Al-Ashtal H.A., Lahr R.M., Abd-Latip N., Sweeney K., Lu H., Weir J., El-Bahrawy M., Steel J.H., Ghaem-Maghami S., Aboagye E.O., Berman A.J, & Blagden S.P. (2015). The RNA-binding protein LARP1 is a post-transcriptional regulator of survival and tumorigenesis in ovarian cancer. Nucleic Acids Research, 44(3), 1227-1246.

+ Open protocol

+ Expand

Profiling LARP1-Bound RNA Transcripts

Check if the same lab product or an alternative is used in the 5 most similar protocols

RNA was immunoprecipitated with 15-μg LARP1 polyclonal antibody (SDIX) or IgG isotype control (CST) following the method described by Keene et al.^{42 (link)} RNA was extracted with Trizol (Life Technologies, Carlsbad, CA, USA) and purified with RNA clean-up and concentration micro kit (Norgen Biotek, Thorold, ON, Canada). Input and immunoprecipitated RNA obtained from four independent experiments were analyzed in duplicate on Agilent exon arrays by Oxford Gene Technology (Begbroke, UK). RNA was quality assessed in a bioanalyser with the RNA 6000 pico kit (Agilent Technologies, Santa Clara, CA, USA), labeled with Agilent low-input QuickAmp WT labeling kit (Agilent Technologies) and hybridized to the Agilent 4x180 K Exon arrays (Agilent Technologies) as per manufacturer protocols.

Mura M., Hopkins T.G., Michael T., Abd-Latip N., Weir J., Aboagye E., Mauri F., Jameson C., Sturge J., Gabra H., Bushell M., Willis A.E., Curry E, & Blagden S.P. (2014). LARP1 post-transcriptionally regulates mTOR and contributes to cancer progression. Oncogene, 34(39), 5025-5036.

+ Open protocol

+ Expand

Exosome-derived miRNA Quantification Protocol

Check if the same lab product or an alternative is used in the 5 most similar protocols

RNA was purified with the “RNA clean-up and concentration” micro kit (Norgen) according to the manufacturer's instructions, after phenol/guanidine-based extraction. For RNA extraction from EVs, Ath-miR159a and cel-miR-248 synthetic oligos were added to each sample to normalize the results of quantitative RT-PCR. Quantitative real-time PCRs were performed with the TaqMan Fast-PCR kit (Applied Biosystems) according to the manufacturer's instructions, using the appropriate TaqMan probes for miRNA quantification, followed by detection with the 7900HT Sequence Detection System (Applied Biosystems). All reactions were performed in triplicate. Simultaneous quantification of GAPDH was used as reference for intracellular miRNA quantification. Simultaneous quantification of RNU48 was used as reference for exosome-related miRNA quantification. The comparative cycle threshold (Ct) method for relative quantification of gene and miRNA expression (User Bulletin #2; Applied Biosystems) was used to determine miRNA expression levels.

D'Avino C., Palmieri D., Braddom A., Zanesi N., James C., Cole S., Salvatore F., Croce C.M, & De Lorenzo C. (2016). A novel fully human anti-NCL immunoRNase for triple-negative breast cancer therapy. Oncotarget, 7(52), 87016-87030.

+ Open protocol

+ Expand

LARP1-Bound RNA Profiling

Check if the same lab product or an alternative is used in the 5 most similar protocols

RNA was immunoprecipitated with 15μg LARP1 polyclonal antibody (SDIX) or IgG isotype control (CST) following the method described by Keene et al^{19 (link)}. RNA was extracted with Trizol (Life Technologies) and purified with RNA clean-up and concentration micro kit (Norgen Biotek). Input and immunoprecipitated RNA obtained from 4 independent experiments were analyzed in duplicate on Agilent exon arrays by Oxford Gene Technology. RNA was quality assessed in a bioanalyser with the RNA 6000 pico kit (Agilent Technology), labeled with Agilent Low-Input QuickAmp WT (LIQA WT) labeling Kit (Agilent Technology) and hybridized to the Agilent 4X 180K Exon arrays as per manufacturer protocols.

+ Open protocol

+ Expand

RNA Extraction and qPCR Analysis

Check if the same lab product or an alternative is used in the 5 most similar protocols

The total RNA from cells was isolated using peqGOLD TriFast™ (peqlab, VWR International GmbH, Darmstadt, Germany) according to the manufacturer’s protocol. RNA samples were purified using the RNA Clean-Up and Concentration Micro Kit (Norgen Biotek Corp., Thorold, Canada), the RNA concentration was determined using spectrophotometry (NanoDrop 8000, Thermo Fisher Scientific), and quality control was performed using an Agilent 2100 Bioanalyzer (Agilent Technologies, Santa Clara, CA, USA).
The reverse transcription of 1 µg of total RNA into cDNA was performed using a High Capacity cDNA Kit (Life Technologies, Thermo Fisher Scientific). For qPCR, 20 ng cDNA per sample (n = 3–4) was analyzed in duplicate using either the Rotor-Gene SYBR Green PCR Kit (Qiagen, Hilden, Germany) or Biozym Blue S’Green qPCR Kit Separate Rox (Biozym Scientific, Hessisch Oldendorf, Germany) and optimized primer pairs for the different transcripts, as well as the housekeeping gene tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein, zeta (Ywhaz) (Table 1). qPCR was performed using a Rotor-Gene Q (Qiagen). Data were analyzed using the threshold cycle number (Ct) in combination with the 2^−ΔΔCt method with Ywhaz as the housekeeping gene.

Golchert J., Staar D., Bennewitz J., Hartmann M., Hoffmann N., Ameling S., Völker U., Peters J, & Wanka H. (2022). Overexpression of Renin-B Induces Warburg-like Effects That Are Associated with Increased AKT/mTOR Signaling. Cells, 11(9), 1459.

+ Open protocol

+ Expand

Gene Expression Profiling of Platelets and Monocytes

Check if the same lab product or an alternative is used in the 5 most similar protocols

We performed expression profiling of platelets and monocytes before and
after 24 hour of HG+HI clamping in a healthy non-diabetic subject. The
platelets and monocytes were collected and resuspended in TRIzol (Life
Technologies, Grand Island, NY). Total RNA was isolated using the RNA Clean-Up
and Concentration Micro-Kit (Norgen Biotek, Thorold, ON, Canada).
Expression profiling of each cell type was performed using U133 Plus 2.0
GeneChips (Affymetrix, Santa Clara, CA). Profiling data was analyzed in Genomics
Suite™ (Partek Inc., St. Louis, Missouri) to detect differentially
expressed mRNAs between conditions. We generated lists of time-dependent
differential mRNA expression (24 hour vs 0 hour fold change). The Applied
Biosystems 7900HT Fast Real-Time PCR System (Life Technologies, Grand Island,
NY) was used to validate the differential expression of select genes. Primers
used to amplify F3 pre-mRNA were GGCTGGATCAGGTCATCTCTAAAG (forward) and
TGTGCCTGGGATCCTCAATAGA (reverse). Primers used to amplify all other genes,
including F3 mRNA, were obtained from Applied Biosystems (Life Technologies)
(Inventoried sequences – proprietary) (Supplement Table 1). Identification
of biological pathways in which gene products participate was determined in
Ingenuity Pathways Analysis software (Ingenuity Systems, Inc., Redwood City,
CA).

Rao A.K., Freishtat R.J., Jalagadugula G., Singh A., Mao G., Wiles A., Cheung P, & Boden G. (2014). Alterations in Insulin-Signaling and Coagulation Pathways in Platelets during Hyperglycemia-Hyperinsulinemia in Healthy Non-Diabetic Subject. Thrombosis research, 134(3), 704-710.

+ Open protocol

+ Expand

Transcriptome Analysis of B. subtilis Strains

Check if the same lab product or an alternative is used in the 5 most similar protocols

A single colony of B. subtilis strains, MS, MGP192, MGP229, MGP254, MGP184 was grown in 10 ml of LB medium for 2 h. The cultures were then diluted 8000-fold in NMS medium and were incubated with shaking at 37°C until they reached an OD_600 nm of 0.3. Total RNA was isolated by acid-phenol extraction as described in (28 (link)). For transcriptome analysis, 35 μg RNA were DNase-treated using the RNase-Free DNase Set (Qiagen) and purified using the RNA Clean-Up and Concentration Micro Kit (Norgen). The RNA concentration was measured using a NanoDrop ND-1000 (Thermo scientific, USA) spectrophotometer; the quality of the RNA preparations was assessed by means of the Agilent 2100 Bioanalyzer (Agilent Technologies, Palo Alto, CA, USA) according to the manufacturer's instructions. Labelling of the sample and hybridization were performed in strand specific conditions by NimbleGen, as previously described (28 (link)). Data processing is described in Supplementary Materials and Methods. Raw data and gene-level expression values after between-sample normalization have been deposited in GEO database (GSE207089). Detailed results of the differential expression analysis are provided in Supplementary Table S3. High-resolution expression profiles along the genome can be explored interactively using the Genoscapist data browser (33 ).

Dervyn E., Planson A.G., Tanaka K., Chubukov V., Guérin C., Derozier S., Lecointe F., Sauer U., Yoshida K.I., Nicolas P., Noirot P, & Jules M. (2023). Greedy reduction of Bacillus subtilis genome yields emergent phenotypes of high resistance to a DNA damaging agent and low evolvability. Nucleic Acids Research, 51(6), 2974-2992.

+ Open protocol

+ Expand

About PubCompare

Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.

We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.

However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.

Ready to get started?

Revolutionizing how scientists
search and build protocols!