One milliliter of Tranzol UP (TransGen Biotech, Beijing, China) was added to the samples, and total RNA was extracted according to the manufacturer’s protocol, and the quantity and quality of the isolated RNA was determined by a NanoDrop 2000 spectrophotometer (Gene Company Limited, Guangzhou, China) and 1% agarose gel electrophoresis at 260 nm and 280 nm, respectively. The first strand of cDNA was extracted using Evo M-MLV Kit AG11728 (Changsha, Hunan, China) and synthesized according to the manufacturer’s instructions. cDNA was stored at −20 °C for real-time quantitative polymerase chain reaction (RT-qPCR). RT-qPCR assays were performed using SYBR® Green Pro Taq HS qPCR (AG11702) and Roche Fluorescence quantification machines (Light Cycler 480II, Rotkreuz, Switzerland). The PCR conditions were set using a thermal programmer at 95 °C for 30 s, 40 cycles of 95 °C for 5 s and 60 °C for 34 s. Each sample was run in triplicate. RT-qPCR primers (Table 2 ) were designed based on published grouper sequences, and relative expression was calculated using the 2−ΔΔCt method [23 (link)].
Tranzol up
Manufactured by Transgene
Sourced in China, United States
TranZol Up is a lab equipment product designed for nucleic acid extraction and purification. It utilizes a proprietary extraction solution to efficiently isolate DNA, RNA, and other genetic materials from a variety of sample types.
Automatically generated - may contain errors
Lab products found in correlation
Goscript reverse transcription system, by Promega (2 mentions)
Cfx96 real time system thermal cycler, by Bio-Rad (2 mentions)
Nanodrop 2000 spectrophotometer, by Gene Tech (1 mentions)
Gotaq qpcr master mix, by Promega (1 mentions)
Dnase 1, by Promega (1 mentions)
Sybr green pcr real master mix, by Tiangen Biotech (1 mentions)
5 protocols using tranzol up
1
RNA Extraction and RT-qPCR Analysis of Grouper Transcripts
2
Quantification of A20 mRNA and miR-873a-5p Expression
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA was extracted from the L4-L6 segments of the spinal cord using TranZol Up (TransGen Biotech, China). Reagents and kits were provided by GeneCopoeia (Guangzhou, China). All procedures were performed according to the manufacturer’s protocols. For quantification of mRNAs, total RNA (1 μg) from each sample was reverse-transcribed into cDNA with a random primer. The relative mRNA expression of A20 was normalized to the expression of the housekeeping gene GAPDH. Primer A20 forward: ATGGTGATGGAAACTGCCTCAT, reverse: ATTTCAGAGATTCCAGCTGCCA. GAPDH forward:AGGTCGGTGTGAACGGATTTG, reverse: TGTAGACCATGTAGTTGAGGTCA. For quantification of miRNAs, aliquots of total RNA (1 μg) from each sample were reverse-transcribed into cDNA. The miRNA primer sets for miR-873a-5p and U6 were purchased from GeneCopoeia (Guangzhou, China). RT-qPCR was performed using an all-in-OneTM miRNA RT-qPCR detection kit. The relative expression levels of miR-873a-5p were normalized to the expression of U6. The specificity of RT-qPCR primers was determined using a melt curve after amplification to show that only a single species of qPCR product was amplified from the reaction. The relative expression of A20 and miR-873a-5p was calculated by the 2−ΔΔCt method. The RT-qPCR experiment was repeated 3 times.
3
Quantitative RT-PCR for β-Catenin Expression
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
From the frozen tissue sections, total RNA was extracted by using Tranzol UP (TransGen, Beijing, China), and β-catenin cDNA was obtained by reverse transcriptase, in accordance with the manufacturer’s instructions. Primer sequences and PCR product lengths were as follows: β-catenin, amplified fragment length 169 bp (gene), upstream: 5′-AGCCACAAGATTACAAGAAAC-3′, downstream: 5′-CCAGAGTGAAAAGAACGATAG-3′; β-actin primer, amplified fragment length 318 bp (internal control), upstream: 5′-ATCATGTTTGAGACCTTCAACA-3′, downstream: 5′-CATCTCTTGCTCGAAGTCCA-3′. DNA was amplified by using the following procedures, with the Trans DNA maker II (TransGen): an initial denaturizing step at 94°C (2 minutes); followed by 35 cycles of a thermal step protocol comprising 94°C (30 s), 60°C (30 s) and 72°C (30 s); the final step utilized 72°C for 10 minutes.
4
Quantitative Real-Time PCR Analysis of ER Stress Response
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
A quantitative real-time PCR (polymerase chain reaction) method was used to analyze the gene expression. After 0, 1, 3, 6, 12, 24, and 48 h of PEG stress treatment, the leaf samples were collected for RNA extraction. Total RNA was extracted using TranZol Up (Transgen, USA) and synthesized complementary DNA by means of the GoScript Reverse Transcription System (Promega, USA) following the manufacturer's instructions. We then conducted quantitative real-time PCR assays using a GoTaq qPCR Master Mix (Promega, USA) on a Thermal Cycler CFX96 Real-Time System (Bio-Rad, USA). The primers used for the ER stress response genes are listed in Table S1 . A two-step fast PCR amplification procedure was used for qPCR, and related gene expression was calculated using the 2−ΔΔCt method, as follows: (1) the Ct value of the gene was normalized against the internal reference gene (β-actin), and ΔCt was calculated; (2) the ΔCt of the gene under different treatments was normalized against the control to calculate ΔΔCt; (3) the 2−ΔΔCt value was then calculated to demonstrate the fold changes of gene expression under different treatments (Livak and Schmittgen, 2001 (link)).
5
Quantitative Real-Time PCR Analysis
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA was extracted using TranZol Up (Transgen, USA). DNase I (Promega, USA) was used to remove genomic DNA. Total RNA extracted from roots was used to generate cDNA samples via random priming with the GoScript Reverse Transcription System (Promega, USA). Six DAPs (including two nitrogen transporters and four randomly selected proteins) were selected for RNA level examination to verify the iTRAQ data and investigate the correlation of protein species abundance with their corresponding mRNA level. The cDNA samples were used as templates and mixed with primers and SYBR Green PCR Real Master Mix (Tiangen, China) for real-time PCR analysis using Thermal Cycler CFX96 Real-Time System (Bio-Rad, USA). The temperature procedure was: 95°C for 15 min followed by 40 cycles of 95°C for 15 s, 60°C for 15 s, and 72°C for 15 s. TaActin was used as a reference gene to normalize the expression level of target genes. 2−ΔΔCT method was employed to calculate the relative gene expression level. Three biological replicates were performed. The primers used for real-time PCR were designed using Primer 5.0 software and are listed in Table S1 .
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!