Cfx384 real time system
The CFX384 Real-Time System is a real-time PCR detection system designed for gene expression analysis, genotyping, and other quantitative PCR applications. The system features a 384-well sample block and supports a wide range of fluorescent dyes and probes. It provides precise temperature control and data analysis capabilities.
Lab products found in correlation
574 protocols using cfx384 real time system
Quantitative Analysis of let-7a and mRNAs by RT-qPCR
Gene Expression Analysis in Cells
Quantitative Real-Time PCR Analysis of Gene Expression
M b-actin F: CCACACCCGCCACCAGTTCG
M b-actin R: TACAGCCCGGGGAGCATCGT
cMyc 3′-F: AAAACAACGAAAAGGCCCCC
cMyc 3′-R: TTCAGAGGTGAGCTTGTGCT
qRT-PCR was also performed using the following TaqMan Gene Expression Assay probes with the TaqMan Universal PCR Master Mix and performed in CFX384 Real-Time System (Bio-Rad) according to the manufacturer’s suggested protocol (Thermo Fisher):
Actin: Mm02619580_g1
Myc: Mm00487804_m1
Tnfaip3: Mm00437121_m1
Cdk1: Mm00772472_m1
Hexb: Mm01282432_m1
Cx3cr1: Mm02620111_s1
Csf1r: Mm01266652_m1
P2ry12: Mm01950543_s1
Analyzing Gene Expression in Mice
Quantifying KIR2DL2 and KIR2DL3 Expression
Quantifying Potato Resistance to P. infestans
Quantifying Intestinal Bacteria in HBV Patients
Quantitative Gene Expression Analysis
Transcriptome Analysis of Celery Under High Temperature
RT-qPCR was performed using SYBR Premix Ex Taq (TaKaRa, Dalian, China). All the steps were followed the manufacturer’s instruction (CFx384TM Real-Time System, Bio-Rad, USA), and the expression level was calculated by the 2-△△Ct method (Pfaffla, 2001 (link)). AgTUB and AtACT2 were served as reference genes for celery and Arabidopsis genes, respectively. All gene primer sequences used in this study were designed using Primer Premier software (version 6.0; Premier Biosoft International: Palo Alto, CA), and the sequences are listed in
qRT-PCR for Validating RNA-Seq Gene Expression
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!