Cfx384 real time system

Total RNA was extracted from γδ T cells treated with DAC using an EasyPure RNA kit (Beijing TransGen Biotech Co., Ltd., Beijing, China) according to the manufacturer’s instructions. After removing genomic DNA contamination with DNase I (Sigma-Aldrich), M-MLV Reverse Transcriptase (Invitrogen) was used to synthesize cDNA. KIR2DL2 and KIR2DL3 mRNA expression was quantified by qRT-PCR using a CFX384TM Real Time system (Bio-Rad, Jurong East, Singapore). The PCR reactions were set up in a final volume of 10 µL with 5 µL SYBR Green qPCR Mix (Roche, Indianapolis, IN, USA) and 10 pmol of each sense and antisense primer. The primer sequences were KIR2DL2 forward: ACCCACTGAACCAAGCTCTA; KIR2DL2 reverse: AGACTCTTGGTCCATTACCG; KIR2DL3 forward: CTCATGGTCGTCAGCATGGT; KIR2DL3 reverse: CTGTGCAGAAGGAAGTGCTG; β-actin forward: AAGATCATTGCTCCTCCTG; β-actin reverse: CGTCATACTCCTGCTTGCTG. The PCR amplification procedure was as follows: 10 s at 95°C followed by 40 cycles of 5 s at 95°C and 30 s at 64°C. Each standard and sample value was determined in three independent experiments. In each experiment, KIR2DL2 and KIR2DL3 expression under each experimental condition was calculated using threshold cycle (Ct) values standardized to β-actin (housekeeping gene), applying the 2^−(ΔCt) method (35 (link)).

The experiment was conducted as a randomized complete block design with two genotypes (resistant and susceptible) inoculated with P. infestans and three replicates over time. Each experimental unit consisted of five pots, each with two plants and five stems inoculated on opposite sides. Following inoculation, the plants were covered with plastic bags for 72h. Disease severity was assessed by measuring lesion length using a digital caliper at 3 d intervals until 9 d post-inoculation (dpi). Lesion length (mm) was used to calculate area under the disease progress curve (AUDPC). Relative biomass of P. infestans in the infected samples was quantified based on quantitative PCR (qPCR) (Asai et al., 2008 ). Genomic DNA was isolated from P. infestans-infected stems (6 dpi) using a DNeasy Plant Mini Kit (Qiagen, Canada). qPCR was performed using IQ SYBR Green Supermix (Bio-Rad, Canada) in a CFX384^TM Real-Time System (Bio-Rad, Canada) according to the manufacturer’s instructions, using specific primers to amplify and detect P. infestans DNA and potato DNA (Supplementary Table S1 at JXB online).

The full length of the 16S rRNA genes of OTU51 (D. succinatiphilus) and OTU50 (A. onderdonkii) (including all strains belonging to the two species) were selected to design and test the primers with Primer-BLAST³. Primers that only targeted the objective bacteria were chosen and later verified by Sanger sequencing of the PCR products that were amplified with the primers; then, these primers were used for further real-time qPCR analysis. In brief, DNA from 32 healthy and HBV infected patients was extracted and adjusted to a concentration of 20 ng/μl. The real-time PCR was carried out using a TB^TM Green Premix Ex Taq^TM II Kit (TaKaRa Biochemicals, China) in 10 μl volumes, which included 5 μl TB Green Premix Ex Taq II (2×), 0.4 μl forward and reverse primer and 0.8 μl DNA. The 16S rRNA gene was used to standardize the results by eliminating variation in the quantity and quality. All reactions were performed with three technical replicates on a CFX384TM Real-Time System (Bio-Rad). The qPCR program consisted of denaturation at 95°C for 30 s and 40 cycles at 95°C for 5 s and at 60°C for 30 s. The relative gene expression abundance was quantified using the 2^–ΔΔCt method.

Gene expression analyses were performed by quantitative polymerase chain reaction (qPCR) in a CFX384^TM Real-Time System (Bio-Rad, El Prat de Llobregat, Spain), according to the requirements of the MIQE guidelines (Bustin et al., 2009 (link)). The primers sequences and GenBank accession numbers used for each reaction are listed in Supplementary Table S1. All the analyses were performed in triplicate wells using 384-well plates with 2.5 μL of iTaq Universal SYBR Green Supermix (Bio-Rad, El Prat de Llobregat, Spain), 250 nM of forward and reverse primers and 1 μL of diluted cDNA for each sample, in a final volume of 5 μL. The qPCR program was performed as previously described (Balbuena-Pecino et al., 2019 (link)). The level of expression of each target gene was calculated relative to the geometric mean of the two most stable reference genes from the three determined for each tissue [ribosomal protein s18 (rps18) and elongation factor 1 alpha (ef1α) in all three tissues], according to the Pfaffl method (Pfaffl, 2001 (link)). Reference genes stability and relative expression of the target genes were determined using the Bio-Rad CFX Manager Software v. 3.1.

The transcriptome data of celery under variable high temperature was obtained by this research group (Li et al., 2022a (link)), and the transcript abundance of AgHSF was calculated in log2(FPKM) to generated cluster heatmaps.
RT-qPCR was performed using SYBR Premix Ex Taq (TaKaRa, Dalian, China). All the steps were followed the manufacturer’s instruction (CFx384TM Real-Time System, Bio-Rad, USA), and the expression level was calculated by the 2^-△△Ct method (Pfaffla, 2001 (link)). AgTUB and AtACT2 were served as reference genes for celery and Arabidopsis genes, respectively. All gene primer sequences used in this study were designed using Primer Premier software (version 6.0; Premier Biosoft International: Palo Alto, CA), and the sequences are listed in Table S1.

To confirm gene expression levels detected by RNA-Seq, quantitative real-time PCR was performed in a Bio-Rad CFX 384TM Real-Time System (Bio-Rad, Munich, Germany) using gene-specific oligonucleotides (Additional file 9). The cDNA for qRT-PCR analyses was synthesized from 1 μg total RNA with the qScript cDNA SuperMix (Quanta Biosciences, Gaithersburg, MD, USA) using the same RNA samples as for the cDNA library construction. Each PCR reaction contained 4 μl MESA Blue qPCR™ Mastermix Plus for SYBR Assay no ROX (Eurogentec, Cologne, Germany), 1 μl cDNA sample and 100 nM gene-specific oligonucleotide primers to a final volume of 8 μl. The primer efficiency of each oligonucleotide was calculated using the following dilution series: 1, 1/2, 1/4, 1/8, 1/16, 1/32, 1/64, and 1/128. The relative expression levels of the transcripts were calculated with reference to the housekeeping gene myosin (Genbank AC: 486090G09.x1). Significant differences in gene expression levels were determined by a two-sided Student’s t-test.