Phosphorimager

Nuclear protein extracts from cultured C2C12 myoblasts were prepared essentially as described by Farrance and Ordahl [14 (link)]. DNA-protein binding was assayed with a double stranded DNA oligonucleotide probe that was biotin 3′end DNA labeled (Pierce) or ³² P-labelled. EMSA were performed as described by Ueyama et al. [15 (link)]. Reactions were performed in binding buffer (20 mM HEPES (pH 7.9), 10% glycerol, 50 mM KCl, 0.05% NP-40, 0.5 mM EDTA, 0.5 mM DTT, and 1 mM PMSF) in the presence of 0.5 µg of Poly (dI-dC), a nonspecific competitor; Mlip protein generated by in vitro coupled transcription-translation using the TNT Coupled T7/Sp6 Wheat Germ extract system (Promega, Madison, WI, USA) for 20 min at room temperature. Products of the binding reactions were resolved by 6%polyacrylamide gel electrophoresis (PAGE) 0.5 X TBE gel for 3–4 h at 10 mM. Biotin labeled probe binding reactions were transferred to a nylon membrane (Millipore, Burlington, MA, USA) and biotin-labeled DNA was detected by chemiluminescence (Promega). Then 32 P-labelled probe gels were dried and analyzed with a phosphorimager (Amersham). DNA oligonucleotide probe sequence for EMSA, the sequence for Six3 (5′-GCA GGA TCC CTA CCC CAA CCC CAG CAA GAA ACG C-3′; 5′-GCG TTT CTT GCT GGG GTT GGG GTA GGG ATC CTG C-3′).

Viral RNA (equivalent of 50 ng CA-p24) in 12 µl buffer (83 mM Tris-HCl pH 7.5, 125 mM KCl) was either used directly for tRNA^lys3 extension or was mixed with primer CN1 (GGTCTGAGGGATCTCTAGTTACCAGAGTC, complementary to nucleotides 123–151 of LAI RNA), heated at 85°C for 2 min, at 65°C for 10 min, followed by slow-cooling to room temperature over 1 h to allow primer annealing. 6 µl 3x RT buffer (9 mM MgCl₂, 30 mM DTT, 150 µg/ml actinomycin D, 30 µM dCTP, 30 µM dGTP, 30 µM dTTP and 1.5 µM dATP [Thermo-Scientific], 0.3 µl α32P-dATP [0.33 MBq/µl, Perkin-Elmer], 22 nM HIV-1 RT [2.5 U per sample; p51/p66 heterodimer; kindly provided by D. Stammers, Glaxo Wellcome Research Laboratories, MRC AIDS reagent project] was added to the tRNA^lys3 and CN1 extension samples. The mixture was incubated at 37°C for 30 min to extend the naturally associated tRNA^lys3 primer or the annealed CN1 DNA primer. The cDNA was precipitated in 25 mM EDTA, 0.3 M NaAc pH 5.2 and 80% EtOH at –20°C. cDNA pellets were washed with 70% ethanol and dissolved in gel-loading buffer II (Ambion). The cDNA was analyzed on a denaturing 6% polyacylamide-urea sequencing gel and bands were quantified using a phosphorimager (Amersham Biosciences) and ImageQuant software.

Total RNAs were isolated from seedlings ground in liquid nitrogen using the guanidinium thiocyanate-CsCl purification method (Sambrook et al., 1989 ). RNAs were separated by electrophoresis in a 1.2% agarose-formaldehyde gel. After transfer to nylon membrane, RNAs were fixed by UV cross-linking. Membranes were hybridized at 65°C with either specific 3′UTR region of AtP5CS1 or with full length of AtProDH1 according to Church and Gilbert (1984 (link)). The fragments were labeled with ³²P-dCTP using Ready-To-GoTM DNA labeling beads. Before hybridization, membranes were stained with methylene blue as a control for RNA loading and transfer. The hybridization signals were quantified using a PhosphorImager (Amersham Biosciences, USA).

AAVs used for in vitro transduction and in vivo PET studies were concentrated to 20 μL and 150 μL volume, respectively, using a spin filter (MWCO 100k). AAV capsids (5–10 μL) were denatured in tris-glycine Sodium dodecyl sulfate (SDS) sample buffer (ThermoFisher Scientific, LC2676) and treated for 2 min at 85 °C. This solution was loaded into and separated on a 14% tris-glycine mini gel (ThermoFisher Scientific, XP00140BOX) under 225 V for 45 min in an electrophoresis chamber filled with tris-glycine SDS running buffer (ThermoFisher Scientific, LC2675). Sharp pre-stained protein standard ladder protein images (ThermoFisher Scientific, LC5800) were loaded to compare the molecular weight of viral proteins. The gel was washed with double distilled water, stained with Coomassie staining solution (ThermoFisher Scientific, LC6060) and imaged using an iPhone 6 cellular phone camera (Fig. 2e, Supplementary Figs. 4b and 5b). The gels loaded with radiolabeled AAVs were further exposed on a phosphor screen in a cassette (Molecular Dynamics, CA) overnight, which was then scanned using the Phosphorimager (Amersham Bio-Science, NJ). For polyacrylamide gel electrophoresis (PAGE) of AAVs in Supplementary Figs. 4b and 5b, the same procedure was performed without gel autoradiography.