Bacterial growth media including brain heart infusion agar, Mac Conkey agar, eosin methyl blue agar, sugarsbroth, triple sugar iron agar, urea broth, methyl red media, Voges-Proskauermedia, and Mueller Hinton agar (MHA) were obtained from Oxoid (Hampshire, UK). Paper discs containing standard antibiotics namely ampicillin 10 µg, amoxycillin 25 µg, chloramphenicol 30 µg, cefuroxyme 30 µg, cefotaxime 30 µg, cefoperazone 75 µg, cefepime 30 µg, meropenem 10 µg, amikacin 30 µg, tetracycline 30 µg, ciprofloxacin 5 µg, levofloxacin 5 µg, co-trimoxazole 25 µg, and ceftazidime 30 µg were purchased from Oxoid (Hampshire, UK). Reagents (chrystal violet, 96% ethanol, iodin, safranin O, ammonium oxalate, oksalat, para-dimethylaminobenzaldehyde, butanol, acid chloride, α-naphtol 5%, KOH 40%, and distilled water) were supplied by Microbiology Laboratory, Faculty of Medicine, Universitas Sumatera Utara (Medan, Indonesia).
Cefoperazone
Manufactured by Thermo Fisher Scientific
Sourced in United Kingdom
Cefoperazone is a cephalosporin antibiotic used in laboratory settings. It is a broad-spectrum antibiotic that can inhibit the growth of a variety of bacteria.
Automatically generated - may contain errors
Lab products found in correlation
Amikacin, by Thermo Fisher Scientific (7 mentions)
Ciprofloxacin, by Thermo Fisher Scientific (6 mentions)
Ceftazidime, by Thermo Fisher Scientific (6 mentions)
Ceftriaxone, by Thermo Fisher Scientific (6 mentions)
Piperacillin, by Thermo Fisher Scientific (6 mentions)
Ampicillin, by Thermo Fisher Scientific (5 mentions)
Tetracycline, by Thermo Fisher Scientific (5 mentions)
Cefepime, by Thermo Fisher Scientific (5 mentions)
Cefotaxime, by Thermo Fisher Scientific (5 mentions)
Meropenem, by Thermo Fisher Scientific (5 mentions)
Aztreonam, by Thermo Fisher Scientific (4 mentions)
Cefoxitin, by Thermo Fisher Scientific (4 mentions)
Piperacillin tazobactam, by Thermo Fisher Scientific (4 mentions)
Trimethoprim sulfamethoxazole, by Thermo Fisher Scientific (4 mentions)
Amphotericin b, by Thermo Fisher Scientific (4 mentions)
Chloramphenicol, by Thermo Fisher Scientific (3 mentions)
Levofloxacin, by Thermo Fisher Scientific (3 mentions)
Gentamicin, by Thermo Fisher Scientific (3 mentions)
Mueller hinton agar (mha), by Thermo Fisher Scientific (2 mentions)
Amphotericin, by Thermo Fisher Scientific (2 mentions)
20 protocols using cefoperazone
1
Bacterial Growth Media and Antibiotic Susceptibility Testing
2
Antimicrobial-Supplemented Culture Media for Campylobacter
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Bolton broth was prepared following the manufacturer’s instruction. It contained 20 mg/L cefoperazone, 20 mg/L vancomycin, 20 mg/L trimethoprim lactate, 10 mg/L amphotericin B, and 5% lysed defibrinated horse blood. C-Bolton broth was prepared using Bolton broth supplemented with potassium clavulanate (Sigma-Aldrich, St. Louis, MO, USA) to a final concentration of 2 mg/L [5 (link)]. Modified charcoal cefoperazone deoxycholate agar (mCCDA, Oxoid) was prepared per the manufacturer’s recommendations using mCCDA antibiotic supplement (32 mg/L cefoperazone and 10 mg/L amphotericin; Oxoid). C-mCCDA was generated by adding 0.5 mg of potassium clavulanate to 1 L of cooled mCCDA [15 (link)].
3
Isolation of Campylobacter and Arcobacter from Stool Samples
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The methods described by Bessede et al. [37 (link)] and Shah et al. [98 (link)] were employed for isolation of Campylobacter and Arcobacter, with slight modifications. Briefly, stool samples were enriched with Campylobacter growth supplement (ThermoScientific, Johannesburg, South Africa) in a Bolton broth (BB) and incubated at 37 °C for 24 h in a microaerophilic atmosphere (MAE) (CampyGenTM, ThermoScientific, Johannesburg, South Africa). Arcobacter was isolated in an Arcobacter broth (AB) supplemented with CAT (cefoperazone, teicoplanin and amphotericin B; Oxoid, Johannesburg, South Africa) and aerobically incubated at 30 °C for 24 h. After incubation, 10 µL of the BB was dropped on a 0.65 µm filter paper placed on a tryptic blood agar plate (TBA) and allowed to incubate at room temperature for 30 min. The filter papers were carefully removed, and the plates were incubated at 37 °C for 24 h in MAE for the cultivation of Campylobacter. For the growth of Arcobacter, 10 µL of the AB was pipetted onto a 0.65 µm filter paper on a blood agar (BA) plate, incubated for 30 min at room temperature, and then the filter papers were carefully removed and the plates were aerobically incubated at 37 °C for 24 h [98 (link),99 (link)].
4
Antibiotic Resistance Profiling of Gram-Negative Bacteria
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The used antibiotics discs were imipenem (10 μg), cefepime (30 μg), amikacin (30 μg), amoxicillin/clavulinic acid (20/10 μg), ampicillin (10 μg), aztreonam (30 μg), cefotaxime (30 μg), cefoxitin (30 μg), ceftazidime (30 μg), ceftriaxone (30 μg) gentamicin (10 μg), piperacillin (100 μg), piperacillin/tazobactam (100/10 μg), cefoperazone (75 μg), ciprofloxacin (5 μg), gatifloxin (5 μg), amoxicillin (5 μg) (Oxoid, United Kingdom). Gram-negative bacilli isolates were suspended in Muller-Hinton broth for preparation of 0.5 McFarland concentrations then spread over Muller-Hinton agar. The discs were applied over the agar then the plates were incubated at 37 °C for 24 hours. The measured inhibition zone diameter around the discs was interpreted as sensitive or resistant according to the guidelines of the Clinical Laboratory Standards Institute (CLSI) [23 ]. Multidrug resistance (MDR) was identified as resistance to three or more of antibiotic classes.
5
Antibiotic Resistance Profiling of E. coli
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
A set of 300 isolated colonies of E. coli were randomly selected for antibiotic resistance profiling against clinically relevant antibiotics. These included 100 from untreated sludge from each WWTP (sample points 1 and 4) and 100 from after MAD at WWTP two (sample point 5). All antibiotic testing was carried out according to CLSI disk diffusion guidelines (Clinical Laboratory Standards Institute, 2017). Selected isolates were first re-streaked from MLGA onto nutrient agar and incubated for 24 hours at 37°C. The isolate was then resuspended in phosphate buffered saline (PBS) to an OD600 of 0.5 using a MacFarland standard, plated onto Müller-Hinton agar (Oxoid) and incubated at 35°C for 18–20 hours. Zones of inhibition were measured to the nearest millimetre.
The antibiotics used were ciprofloxacin (5 μg), gentamicin (10 μg), meropenem, (10 μg), ampicillin (10 μg) (used to test for amoxicillin resistance (Clinical Laboratory Standards Institute, 2017)), trimethoprim (5 μg), and four different third generation cephalosporins—ceftazidime (30 μg), cefoperazone (75 μg), ceftiofur (30 μg) and cefpodoxine (30 μg) (all antibiotics were from Oxoid., Basingstoke, UK).
The antibiotics used were ciprofloxacin (5 μg), gentamicin (10 μg), meropenem, (10 μg), ampicillin (10 μg) (used to test for amoxicillin resistance (Clinical Laboratory Standards Institute, 2017)), trimethoprim (5 μg), and four different third generation cephalosporins—ceftazidime (30 μg), cefoperazone (75 μg), ceftiofur (30 μg) and cefpodoxine (30 μg) (all antibiotics were from Oxoid., Basingstoke, UK).
6
Antimicrobial Susceptibility Testing of Bacteria
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The antimicrobial sensitivity profile of recovered bacteria was determined using the disk diffusion assay on Muller-Hinton agar (MH; Oxoid, Cheshire, UK) according to the standards and interpretive criteria described by the Clinical and Laboratory Standards Institute guidelines (CLSI, 2014 ). The strains were tested for susceptibility to a panel of antibiotics (Oxoid, UK): amoxicillin (AML10), amoxicillin/clavulanic acid (AMC30), ticarcillin (TIC75), ticarcillin/clavulanic acid (TIM85), piperacillin (PRL100), piperacillin/tazobactam (TZP110), cephalothin (KF30), cefoxitin (FOX30), ceftriaxone (CRO30), cefoperazone (CFP30), ceftazidime (CAZ30), cefotaxime (CTX30), cefepime (FEP30), imipenem (IPM10), aztreonam (ATM30), streptomycin (S10), kanamycin (K30), amikacin (AK30), gentamicin (CN10), tobramycin (TOB10), nalidixic acid (NA30), ciprofloxacin (CIP5), erythromycin (E15), tetracycline (TE30), trimethoprim-sulfamethoxazole (SXT25), chloramphenicol (C30) and fosfomycin (FOS50).
7
Antibiotic Resistance Profiling of A. baumannii
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Antibiotic susceptibility testing (AST) was performed by the Kirby–Bauer disc diffusion method using a 0.5 McFarland bacterial suspension spread over Mueller Hinton agar (Oxoid Ltd. Bashingstore Hampshire, UK). Seventeen antibiotic discs were utilized to determine the multidrug-resistant A. baumannii according to Clinical and Laboratory Standards Institute guidelines [17 ] (CLSI-2015). The susceptibility of the isolated strains was tested against amikacin (30 µg), aztreonam (30 µg), Cefepime (30 µg), Cefoperazone (75 µg), ceftazidime (30 µg), levofloxacin (5 µg) Ceftriaxone (30 µg), ciprofloxacin (5 µg), gentamycin (10 µg), imipenem (10 µg), (5 µg), meropenem (10µg), piperacillin-tazobactam (100/10 µg), piperacillin (100 µg), tetracycline (30 µg), tobramycin (10 µg), sulfamethoxazole-trimethoprim (2.75/1.25 µg), and colistin (10 µg) (all from Oxoid, UK). The strains were recorded as sensitive, intermediate, or resistant based upon CLSI-2017 guidelines for disk diffusion method–Mueller Hinton agar; Pseudomonas aeruginosa ATCC 27853 and Escherichia coli ATCC 25922 were used as quality control (QC). The QC strains for antimicrobial testing were as is recommended in the CLSI-2015 guidelines [17 ].
8
Isolation and Molecular Identification of Campylobacter jejuni
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Stool sample was directly streaked onto modified Charcoal Cefoperazone Deoxycholate Agar (CCDA) (Oxoid, Hampshire, England) containing CAT antibiotic supplement (Cefoperazone 8 mg/litter, Amphotericin B 20 mg/litter, Teicoplanin 8 mg/litter) (Oxoid, Hampshire, England) These plates were incubated under microaerophilic conditions (Oxoid Campygen sachets Oxoid, Hampshire) for 48 to 72 h at 42 °C [25 (link)]. The isolated colonies were primarily identified on the basis of Gram staining, catalase, hippurate hydrolysis and oxidase activity. For molecular identification, DNA extraction was performed using phenol/chloroform method which was a modified version of Cheng and Jiang [26 (link)]. A negative extraction control with PBS and positive control was included in the extraction as well as in each PCR runs in each batch. Species specific primer for the detection of C. jejuni are HipO-F, (GACTTCGTGCAGATATGGATGCTT) and HipO-R, (GCTATAACTATCCGAAGAAGCCATCA) were used [27 (link)]. Thermo cycler conditions were 95 °C for 5 min, followed by 35 cycles of 95 °C for 30 s, 52 °C for 45 s and 72 °C for 60s, and finally 72 °C for 10 min. Cj255 was used as positive control [27 (link)].
9
Isolation and Identification of Foodborne Pathogens
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The presence of Salmonella and Yersinia were studied by enrichment and selective agar plates [29 (link)]. For Salmonella isolation enrichment on semisolid Rappaport-Vassiliadis (MSRV, Labema) for 24 h at 42 °C was used before inoculating on selective xylose-lysine-deoxycholate (XLD, Labema) plates which were incubated for 24 h at 37 °C. Cold enrichment at 6 °C for at least three weeks was used for Yersinia isolation. After cold enrichment, 10 µL was inoculated on CIN plates which were incubated at 30 °C for 20–24 h. Up to four typical colonies on XLD and CIN plates were sub-cultured on blood agar plates and identified with API 20E (BioMerieux, France). Serotyping was done with commercial antisera (Denka Seikan, Japan). The presence of Campylobacter was studied by plating (1 g feces/1 mL 0.9% saline) on modified charcoal cefoperazone deoxycholate agar (mCCDA) with cefoperazone and amphotericin (Oxoid, Basingstoke, UK) and identification was done by gram staining and PCR according to Olkkola et al. [28 (link)].
10
Antimicrobial Susceptibility Testing Protocol
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The susceptibility of the isolated bacteria to different antimicrobials was tested by the standard disc diffusion method (Modified Kirby-Bauer) using Muller Hinton agar according to guidelines of the Clinical and Laboratory Standards Institute [11 ].
The following commercial antimicrobial discs were used; piperacillin (10 μg), amoxicillin–clavulanic acid (20, 10 μg); gentamicin (10 μg), amikacin (30 μg), imipenem (10 μg), meropenem (10 μg), cephalosporins: cefoxitin (30 μg), cefoperazone (75 μg), ceftriaxone (30 μg), cefotaxime (30 μg), ceftazdime (30 μg), cefipeme (30 μg), levofloxacin (5 μg), erythromycin (15 μg), azithromycin (15 μg), tetracycline (30 μg), and trimethoprim/sulfamethoxazole (1.25/23.75 μg), tigecycline (Tig 15 μg) (Oxoid, Basingstoke, UK).
Regarding vancomycin and colistin, the minimum inhibitory concentration (MIC) was determined according to CLSI guidelines.
As quality control strains, Pseudomonas aeruginosa ATCC® 27853™ and Escherichia coli ATCC® 25922™ were used (American Type Culture Collection Global Bioresource Center, USA).
Multidrug-resistant (MDR) and pan drug-resistant (PDR) bacterial isolates were identified based on susceptibility patterns to different classes of antimicrobials. Multidrug-resistant strains exhibited resistance to three or more antimicrobial drug classes, while pan drug-resistant strains showed resistance to all drug classes [13 ].
The following commercial antimicrobial discs were used; piperacillin (10 μg), amoxicillin–clavulanic acid (20, 10 μg); gentamicin (10 μg), amikacin (30 μg), imipenem (10 μg), meropenem (10 μg), cephalosporins: cefoxitin (30 μg), cefoperazone (75 μg), ceftriaxone (30 μg), cefotaxime (30 μg), ceftazdime (30 μg), cefipeme (30 μg), levofloxacin (5 μg), erythromycin (15 μg), azithromycin (15 μg), tetracycline (30 μg), and trimethoprim/sulfamethoxazole (1.25/23.75 μg), tigecycline (Tig 15 μg) (Oxoid, Basingstoke, UK).
Regarding vancomycin and colistin, the minimum inhibitory concentration (MIC) was determined according to CLSI guidelines.
As quality control strains, Pseudomonas aeruginosa ATCC® 27853™ and Escherichia coli ATCC® 25922™ were used (American Type Culture Collection Global Bioresource Center, USA).
Multidrug-resistant (MDR) and pan drug-resistant (PDR) bacterial isolates were identified based on susceptibility patterns to different classes of antimicrobials. Multidrug-resistant strains exhibited resistance to three or more antimicrobial drug classes, while pan drug-resistant strains showed resistance to all drug classes [13 ].
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!