Total rna extraction kit
The Total RNA Extraction Kit is a laboratory tool designed for efficient and reliable extraction of total RNA from a variety of biological samples. The kit employs a specialized method to isolate high-quality RNA, which can then be used for various downstream applications, such as gene expression analysis, RT-PCR, and RNA sequencing.
Lab products found in correlation
48 protocols using total rna extraction kit
Total RNA Extraction and RNA-Seq Library Preparation
Quantitative Real-Time PCR Analysis of CBXs Expression
Isolation and Characterization of VsPCS1
Investigating Mitochondrial Regulation in HK-2 Cells
Quantitative RT-PCR Analysis of Gene Expression
Stemness and Differentiation Gene Expression Analysis
Integrative Transcriptome Analysis of Marchantia
Quantifying lncRNA HOTAIRM1 in OSCC Cells
HOTAIRM1
F: 5′-TTGACCTGGAGACTGGTAGC-3′
R: 5′-TTCAGTGCACAGGTTCAAGC-3′;
β-actin
F:5′ ATGAACTGGCGAGAGGTCTGT3′
R:5′ CCAGGAATGAGTAACACGGAGT3′.
Quantitative Analysis of Inflammatory Markers
Quantitative Real-Time RT-PCR Analysis of Plant Gene Expression
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!