Quikchange 2 e site directed mutagenesis kit

Mutant forms of T211A, Y218A, and S349A were prepared using QuikChange II-E Site-Directed Mutagenesis Kit (Agilent Technologies, Santa Clara, CA, USA). Plasmids with wild-type genes were used as templates and primers (Table 1) were designed according to the manufacturer’s manual. The mutant plasmids were sequenced by the company (Sangon Biotech, Shanghai, China).

The online program Scansite (http://scansite.mit.edu) was used to predict potential PKA phosphorylation sites in rNa_V1.4. Optimal phosphorylation sites for particular protein Ser/Thr kinases were predicted using the matrix of selectivity values for amino acids at each position relative to the phosphorylation site as determined from the oriented peptide library technique. We evaluated the surface accessibility, score, and percentile parameters of all candidate PKA phosphorylation sites and chose two candidates, S56 and T21, for further study. We performed site-directed mutagenesis at the S56 and T21 sites using the Quikchange II-E Site-Directed Mutagenesis Kit (Agilent Technologies). The PCR primers used are as follows:
rNa_V1.4S56A: 5'-GGAAGCCACGCGCTGACCTGGAAGC-3'
5'-GCTTCCAGGTCAGCGCGTGGCTTCC-3'
rNaV1.4T21A: 5'-TGCCTGCGCCCCTTCGCCCCAGAGTCCCTGGCA-3'
5'-TGCCAGGGACTCTGGGGCGAAGGGGCGCAGGCA-3'

The closest predecessor germlines for each scFv were identified using IMGT/V-Quest [60 (link)]. Sequences were compared to find the divergent amino acids. Then, mutations were restored to its germline amino acid by the QuikChange II-E Site-Directed Mutagenesis Kit (Agilent, Santa Clara, CA, USA), as described above for epitope mapping. The K_D values for each construct were determined as yeast-displayed scFvs using flow cytometry. Changes that did not reduce binding affinity were incorporated. After scFv gene optimization, the final clone was used as a template to continue with the next step of affinity maturation.

pRK5-HA-GST-RagD wt (#19307) and pRK5-HA-GST-RagD S77L (#19308) were a kind gift from D. Sabatini (Addgene plasmids). The plasmids carrying the human mutations: pRK5- HA-GST-RagD P88L, pRK5-HA-GST-RagD S76L, pRK5-HA-GST-RagD S76W, pRK5-HA-GST-RagD P119L, pRK5-HA-GST-RagD P119R, pRK5-HA-GST-RagD I221K, pRK5-HA-GST-RagD T97P were generated using the QuikChange II-E Site-Directed Mutagenesis Kit (no. 200555, Agilent Technologies). pTRIP-GPNMBprom-NUC-mCherry was generated by synthesis of the GPNMB promoter region sequence (448 bp) flanked by NdeI and NheI restriction enzyme sequences. The fragment was cloned into a lentiviral vector NUC-mCherry-pTRIP plasmid (was a gift from Thomas Weber Addgene cat. No. 163520) changing the CMV promoter sequence with the GPNMB promoter sequence between the NdeI and NheI restriction sites.

Employing the QuikChange II-E Site-Directed Mutagenesis Kit (Agilent #200523) per the manufacture’s protocol, a wild-type Flag-HA-CYLD expression vector [73 (link)]. (Addgene #22544) was mutated to reflect the two novel CYLD missense mutations, N300S and D618A. Synthetic forward and reverse oligonucleotide primers (Sigma-Aldrich) were designed to harbor the desired point mutation with high CYLD binding affinity in the region of interest. To create the N300S CYLD mutation, forward primer ACATCAGTGATATCATCCCAGCTTTAT and reverse primer GCAATAGAATTGTACTTTCAACACACG were used. To develop the D618A CYLD mutation, gggtctaagtaacacagtggccagaacagaactaaaagc and gcttttagttctgttctggccactgtgttacttagaccc were used for the forward and reverse primers, respectively. Sanger sequencing performed by Eton Bioscience (San Diego, CA, USA) confirmed targeted mutation success.

To confirm the energetically important amino acids on the BoNT/E domain critical for mAb binding, single alanine mutants of BoNT/E domains in the putative fine epitope were prepared using the QuikChange II-E Site-Directed Mutagenesis Kit (Agilent Tech, Palo Alto, CA, USA) following the manufacturer’s instructions. Briefly, primers containing the mutation were used for PCR amplification with the plasmid pYD2 containing the corresponding BoNT/E domain gene as a template for 18 cycles. The PCR product was digested by DpnI to remove the parental methylated and hemi-methylated DNA, which was then purified by StrataClean Resin and transformed into E. coli XL1-Blue. The alanine mutants for each gene were then individually transformed into EBY100, grown in SD-CAA medium, and induced for expression on the surface of EBY100. DNA sequencing was used to verify each construct. The ΔΔG of binding for each alanine mutant was determined by comparing the IgG K_D for the alanine mutant domain to the wild-type K_D as previously described [37 (link)].