The largest database of trusted experimental protocols

17 protocols using ethyl acetate

1

Fabrication of Serotonin Aptamer Biosensor

Check if the same lab product or an alternative is used in the 5 most similar protocols
3,4-Ethylenedioxythiophene (EDOT), polyacrylonitrile (PAN), dimethylformamide (DMF), ferric chloride, 4-(4,6-dimethoxy-1,3,5-triazin-2-yl)-4-methylmorpholinium chloride (DMTMM), hexamethyldisilazane (HMDS), 3,4-Dimethoxythiophene, p-toluenesulfonic acid monohydrate (pTsOH·H2O), butylated hydroxytoluene (BHT), tetrahydrofuran (THF), and Sylgard 184 polydimethylsiloxane (PDMS) were obtained from Sigma–Aldrich. Ethanol, toluene, mEthanol, hexane (Hex), hydrochloric acid (HCl), and ethyl acetate (EtOAc) were obtained from Samchun. Sodium hydroxide (NaOH) was purchased from Daejung. (S)-Methyl 2,3-dihydroxypropanoate (Methyl glycerate) was purchased from Combi-Block. AZ5214E was obtained from Clariant. A serotonin aptamer with the sequence 5′-CGACTGGTAGGCAGAT AGGGGAAGCTGATTCGAGCGTGGGTCG[C6 Amine]-3′ was synthesized by Bioneer. Phosphate buffered saline (PBS) pH 7.4 (1 ×) was purchased from Gibco™, and simulated blood serum and artificial CSF were purchased from Biochemazone. All reagents and solvents were used as received without further treatment.
+ Open protocol
+ Expand
2

Synthesis of Conjugated Polymers

Check if the same lab product or an alternative is used in the 5 most similar protocols
Sodium, FeCl3, 2-methyl-2-butanol, 2-ethyl hexyl bromide, Pd(PPh3)4, CuI, (i-Pr)2NH, ethynyltrimethylsilane, N-bromosuccinimide, 3,4-ethylenedioxythiophene, and 2,5-dibromothiophene were purchased from Sigma-Aldrich. DMF and 2-carbonitrile thiophene were purchased from Alfa Aesar Co. Tetrahydrofuran, dichloromethane, toluene, methanol, ethyl acetate, hexane, CHCl3, and potassium carbonate were purchased from Samchun Pure Chemicals. Tetrahydrofuran (THF), diethyl ether, toluene, and methylene chloride were used after distillation in the presence of Sodium/benzophenone or calcium hydride under nitrogen gas.
+ Open protocol
+ Expand
3

Ovalbumin-Loaded Silica Nanoparticles for Immunotherapy

Check if the same lab product or an alternative is used in the 5 most similar protocols
Rhodamine B isothiocyanate
(RITC), (3-aminopropyl)trimethoxysilane (APTMS), cethyltrimethylammonium
bromide (CTAB), ammonium hydroxide, tetraethylorthosilicate (TEOS),
and ovalbumin (OVA) were purchased from Sigma-Aldrich (St. Louis,
MO, USA). HCl, methanol, and ethyl acetate were purchased from SamChun
Chemical (Seoul, Korea). Bovine serum albumin (BSA) was purchased
from Millipore (Billerica, MA, USA), CpG oligodeoxynucleotide was
purchased from Bioneer (Daejeon, Korea). Recombinant murine GM-CSF
was purchased from Peprotech (Rocky Hill, NJ, USA). Antibodies against
the following proteins were used: CD11c-APC, MHC class-II-FITC, CD86-Vioblue,
MHC class-I(H-2Kb)/SIINFEKL-PE-Vio770, CD3e-FITC, CD4-PE-Vio770,
CD8-APC, IFN-γ-FITC, CD44-Vioblue, and CD62L-PE were purchased
from Miltenyi Biotec (Bergisch Gladbach, Germany) and H-2Kb/SIINFEKL tetramer-PE was purchased from MBL life science (Woburn,
MA). IL-12 and TNF-α ELISA kits were purchased from BD science.
+ Open protocol
+ Expand
4

Synthesis of Heterocyclic Compounds using Transition Metal Complexes

Check if the same lab product or an alternative is used in the 5 most similar protocols
The 4-methoxybenzoic acid, pyridine-2,6-dicarbaldehyde, phosphorous oxychloride, carbohydrazide, isocyanate and isothiocyanates, Hydrazine hydrate (80%), TEA, CS2, KOH, sodium hydrogen carbonate, and glacial acetic acid were purchased from Sigma-Aldrich, Darmstadt, Germany. The chloride salts of the transition metals were obtained from Aldrich and Alfa Aesar. Ethanol, mEthanol, chloroform, deionized water, acetonitrile, dimethyl sulfoxide, petroleum ether, ethyl acetate, n-hexane, toluene (Samchun Chemicals, Seoul, Korea), H2SO4, acetic acid, and HCl (Jin Chemical and Pharmaceutical Co. Ltd., Seoul, Korea) were used in this experiment. Urease from jack bean (EC 3.5.1.5), Thio-urea, sodium nitroprusside, and active chloride were purchased from Sigma (St. Louis, MO, USA). Stock solutions of the reducing substrates were prepared in phosphate buffer (20 mM, pH 6.8).
+ Open protocol
+ Expand
5

PLGA-Based Nanoparticle Formulation Development

Check if the same lab product or an alternative is used in the 5 most similar protocols
PLGA polymer with a lactide/glycolide ratio of 50:50 and a molecular weight 38,000–54,000 kDa (Resomer® 504, Evonik, Darmstadt, Germany), polyvinyl alcohol (PVA), sodium lauryl sulfate (SLS), dimethyl sulfoxide (DMSO), and phosphate-buffered saline (PBS) tablets were purchased from Sigma-Aldrich (St Louis, MO, USA). Sodium hyaluronate of microbial origin (molecular weight 1,500–2,500 kDa) was purchased from Humedix (Sungnam, South Korea). Eudragit RL (a copolymer of ethyl acrylate, methyl methacrylate, and a low content of methacrylic acid ester with quaternary ammonium groups) was kindly provided by Evonik. The fluorescent probe 1,1′-dioctadecyl-3,3,3′,3′ tetramethylindotricarbocyanine iodide (DiR) was purchased from Marker Gene Technologies, Inc. (Eugene, OR, USA). Ethyl acetate and dichloromethane were purchased from Samchun Pure Chemical (Kyunggi-do, South Korea). Acetonitrile and methanol were obtained from J.T. Baker (Phillipsburg, NJ, USA). All other chemicals used were of the highest commercial grade available.
+ Open protocol
+ Expand
6

Activated Charcoal-based Polymer Characterization

Check if the same lab product or an alternative is used in the 5 most similar protocols
Activated charcoal (4–14 mesh), 1-butanol
(BuOH, >99.5%), galactaric acid (Gal-dA, 97%, also known as mucic
acid), 3-methyl-1-butanol (98%, also known as isoamyl alcohol), molecular
sieves type 3 Å (UOP, pellets, 3.2 mm), poly(vinyl chloride)
(PVC, powder, Mw ∼80000, Mn ∼47000), sodium carbonate (Na2CO3, >99.5%), sodium chloride (NaCl, 99%), sulfuric
acid
98% fume (H2SO4), tetrahydrofuran (THF, anhydrous,
inhibitor-free, >99.9%), and p-xylene (PX, 99%)
were
all purchased from Sigma-Aldrich (Korea). Analytical-grade solvents
(n-hexane, ethyl acetate, methanol, etc.) were obtained
from Samchun Chemicals (Korea). Bis(2-ethylhexyl) phthalate (DOP,
>98%) was purchased from TCI Chemicals (Japan), which was used
as
the reference plasticizer chemical.
+ Open protocol
+ Expand
7

Graphite-Based Thermal Conductive Adhesive Synthesis

Check if the same lab product or an alternative is used in the 5 most similar protocols
Butyl acrylate (>99%), 2-ethylhexyl acrylate (>99%), ethyl acrylate (>99%), 2-hydroxyethyl acrylate (>95%), acrylic acid (>99%), abietic acid (>80%), triethylamine (>99%), and 2-isocyanatoethyl methacrylate (>98%) were purchased from Tokyo Chemical Industry. Tris(4-hydroxyphenyl)methane triglycidyl ether (>95%) and dibutyltin dilaurate (95%) were purchased from Sigma-Aldrich Korea Ltd. (Yongin, Korea). Toluene (99.5%), ethyl acetate (99.5%), and methyl ethyl ketone (99.5%) were purchased from Samchun Chemical (Pyeongtaek, Korea). Azobisisobutyronitrile (AIBN, 98%) was purchased from Junsei Chemical (Tokyo, Japan). All chemicals were used as received without further purification. The epoxy crosslinker was used after dilution to a solid content of 5 wt% with Toluene. A 17-μm-thick graphite sheet was purchased from Tanyuan technology (Changzhou, China). A silicone-coated polyethylene terephthalate (PET) film and a polyethylene terephthalate (PET) film were purchased from SKC (Seoul, Korea). A stainless steel (SS) plate was purchased from MMSTECH (Bucheon, Korea). The micro structure of the g-TC film was analyzed using a scanning electron microscope (SEM, JSM 6380, JEOL, Tokyo, Japan) and a digital microscope (MXB-5000REZ, HIROX, Tokyo, Japan).
+ Open protocol
+ Expand
8

Biopolymer-based Drug Delivery System

Check if the same lab product or an alternative is used in the 5 most similar protocols
Poly(d,l-lactic-co-glycolic acid (PLGA: 50/50, Mw: 33,000 Da) was purchased from Birmingham Polymers, Inc. (Birmingham, AL, USA). Poly(vinyl alcohol) (PVA, 87–89% hydrolyzed, Mw: 85,000–124,000 Da), Dex, dimethyl sulfoxide (DMSO), maleic anhydride, fluorescein (FI), IR-783, 4-(4,6-dimethoxy-1,3,5-triazine-2-yl)-4-methyl-morpholinium chloride (DMTMM), sodium azide, propargyl amine, copper sulfate, ascorbic acid, and pyridine were bought from Sigma-Aldrich (St. Louis, MO, USA). Ethyl acetate, acetonitrile (ACN), toluene, and ether were used as received from Samchun (Gyeonggi, Korea). Dimethylformamide (DMF) were acquired from Junsei Chemical Co. (Chuo-ku, Tokyo), whereas methyltetrazine-PEG4-amine (TET) and trans-cyclooctene-amine (TCO) were from Click Chemistry Tools (Scottsdale, AZ, USA). Pluronic F-127 was used as received from BASF SE (BASF, Ludwigshafen, Germany). All other chemicals were of analytical grade and used without further purification. HA (1.0 MDa) was used as received from Humedix (Gyeonggi, Korea).
+ Open protocol
+ Expand
9

HPTLC Analysis of Phenolic Compounds

Check if the same lab product or an alternative is used in the 5 most similar protocols
Chemicals.
HPTLC plate silica gel 60 F254 (20 × 10 cm, Merck, Darmstadt, Germany); MeOH; toluene; ethyl acetate (Samchun, Korea); formic acid purity of 99.9% (Biochem, France); rosmarinic acid and caffeic acid (Sigma-Aldrich, Germany) were purchased. All materials were of analytical grade.
+ Open protocol
+ Expand
10

Synthesis of Functionalized Furan Derivatives

Check if the same lab product or an alternative is used in the 5 most similar protocols
All chemicals used in the experiments were purchased from commercial sources: 2,5-bis(hydroxymethyl)furan (Nanjing Sunshine Chemical Co., Ltd., Nanjing, China), 6-Bromo-1-hexanol (TCI, Tokyo, Japan), 3-Bromo-1-propanol (Sigma Aldrich, St. Louis, MO, USA), 1,4-Benzenedimethanol (TCI, Tokyo, Japan), tert-Butyl(chloro)diphenylsilane (Sigma Aldrich, St. Louis, MO, USA), imidazole (Alfa Aesar, Ward Hill, MA, USA), erythritol (TCI, Tokyo, Japan), hexamethylene diisocyanate (TCI, Tokyo, Japan), 4,4′-diisocyanato-methylenedicyclohexane (TCI, Tokyo, Japan), cesium carbonate (TCI, Tokyo, Japan), tetrabutylammonium fluoride (Alfa Aesar, Ward Hill, MA, USA), dibutyltin dilaurate (TCI, Tokyo, Japan), ammonium chloride (Samchun Chemical, Seoul, Korea), sodium sulfate (Samchun Chemical, Seoul, Korea), all solvents including dichloromethane, N-methyl-2-pyrrolidone, tetrahydrofuran, ethyl acetate, dimethyl sulfoxide, dimethylformamide (Samchun Chemical, Seoul, Korea) and deuterated solvents for nuclear magnetic resonance (Cambridge Isotope Laboratories, Tewksbury, MA, USA).
+ Open protocol
+ Expand

About PubCompare

Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.

We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.

However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.

Ready to get started?

Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required

Sign up now

Revolutionizing how scientists
search and build protocols!