Bioanalyzer system

Purified ChIP DNA was quantified by Qubit HS assay kit. Libraries were prepared with 3–7.5 ng DNA using the TruSeq ChIP Sample Prep Kit (Illumina, San Diego, CA). In brief, DNA was end repaired with a combination of T4 DNA polymerase, E. coli DNA Pol I large fragment (Klenow polymerase) and T4 polynucleotide kinase. Size-selection of adaptor-ligated ChIP-DNA was performed using SPRIselect magnetic beads (Beckman Coulter) with DNA size ranging from 250 to 350 bp. Final libraries were amplified for 11 cycles and purified using AMPure XP beads (Beckman Coulter). ChIP-seq libraries were quality controlled on a Bioanalyzer system (Agilent, Santa Clara, CA) and sequenced using an Illumina HiSeq 2500 platform. Barcoded libraries were sequenced in a multiplexed fashion with four libraries at equimolar concentration, with single-end reads of 50 bases.

RNA from TRAP samples and TRAPnf samples were converted to cDNA using the Ovation RNA-seq v2 (NuGEN Technologies, Inc., Redwood City, CA) and cDNA libraries were prepared by Ovation Ultralow System V2 (NuGEN). Briefly, ribosomal RNA was depleted from 2 ng of total RNA using the RiboMinus Eukaryote Kit RNA-Seq (Invitrogen). Ribosomal RNA-depleted samples were lyophilized (Freeze Dry System, Labconco) and resuspended in RNase-free water for cDNA synthesis. cDNA was cleaned up using the MiniElute Reaction Cleanup Kit (Qiagen) and 500 ng of cDNA were fragmented by sonication into a 200 bp peak (Covaris, Inc., Woburn, MA). A total of 500 ng of fragmented cDNA was used for library preparation. The quality of fragmented cDNA and cDNA libraries were assessed by the Stanford Protein and Nucleic Acid Facility using a Bioanalyzer system with the High-sensitivity DNA chip (Agilent). RNA sequencing was performed on an Illumina HiSeq 2500 system (Elim Biopharmaceuticals, Inc., Hayward, CA), with TRAP samples from engrafted tissue run as single lane 125 bp paired-end reads, and TRAPnf and TRAP from in vitro samples as multiplexed (4 samples per lane), 50 bp paired-end reads.
For quantitative PCR 300 ng of RNA (500 ng for the ‘No transplantation, No TRAP’ BMP6 experiment) was converted to cDNA using the High Capacity RNA-to-cDNA kit (Thermo Fisher Scientific) according to the manufacturer.

RNA was extracted from fibroblast cell pellets using PureLink RNA Mini Kit (Ambion) including on column DNAse treatment per manufacturer recommendations. Quality control of RNA samples was performed using a Bioanalyzer system (Agilent).

Biotinylated tether and biotinylated primed DNA oligo were added to avidin-labeled beads before tethering the beads within a glass microfluidic chip. Avidin beads were labeled with a tether by washing the beads 2× in 10 mM Tris (pH 8) with 50 mM NaCl and 0.1% triton X-100, resuspending in 10 mM Tris (pH 8) with 1 M NaCl and incubating with the dsDNA tether at a ratio of ~1 tether per bead for 30 minutes. Beads were then incubated with 6 µM of a biotinylated primed template (TEG or photocleavable PC-biotin-5’GAAGAGCCAAGGACAGGTAC3’ (primer) and either 5’ATCGCTGCCGTACCTGTCCTT GGCTCTTC3’, or 5’AGCTGTACCTGTCCTTGGCTCTTC3’ or 5’AAAAAAATGGAAAAAA AAAAAAAATCCCCCCCCACCCCGTACCTGTCCTTGGCTTTC3’ (templates) from IDT) for 2 hours, washed in 10 mM Tris (pH 8) with 50 mM NaCl and 0.1% triton X-100 and resuspended in 10 mM Tris (pH 8) with 50 mM NaCl and 2% 5K DNA gel (Caliper Life Sciences, Mt. View, CA) containing polydimethylmethacrylate to suppress electroosmotic flow in the microfluidic channels. The number of templates bound per bead was estimated by binding oligos with photocleavable biotin groups (Integrated DNA Technologies, San Diego, CA) to a known number of avidin beads, washing away unbound oligos, photolyzing the biotin linkage and measuring the released oligo concentration using the DNA1000 assay on the Agilent Bioanalyzer system.