Eight adult males harvest mice (M. minutus) were captured by Sherman live traps from a grassy field of Wuling Farm in central Taiwan, located approximately 2200 m above sea level (24°24′N, 121°18′E). Four of the 8 harvest mice were sacrificed soon after capture. The gastrocnemius muscles were taken from the animals, minced and put in the RNAlater RNA stabilization solution (Thermo Fisher Scientific, Wilmington, DE, USA). The above procedures were performed at the native altitude. The remaining four animals were transferred to the laboratory in Tunghai University, Taichung, Taiwan, located approximately 200 m above sea level (24°18′N, 120°60′E) (Figure 1 ), and were housed in cages at ambient temperature for three weeks, and then their muscle tissues were sampled using the same procedures mentioned above.
Rnalater rna stabilization solution
Manufactured by Thermo Fisher Scientific
Sourced in United States
RNAlater RNA Stabilization Solution is a reagent designed to rapidly stabilize and preserve RNA in biological samples. It inhibits RNase activity and maintains the RNA integrity during sample collection, storage, and transportation, allowing for accurate gene expression analysis.
Automatically generated - may contain errors
Lab products found in correlation
Trizol reagent, by Thermo Fisher Scientific (12 mentions)
Agilent 2100 bioanalyzer, by Agilent Technologies (5 mentions)
Nanodrop spectrophotometer, by Thermo Fisher Scientific (4 mentions)
Rneasy mini kit, by Qiagen (3 mentions)
Rneasy plus mini kit, by Qiagen (3 mentions)
Platinum sybr green qpcr supermix udg, by Thermo Fisher Scientific (2 mentions)
Powertrack sybr green master mix, by Thermo Fisher Scientific (2 mentions)
Superscript 4 reverse transcriptase, by Thermo Fisher Scientific (2 mentions)
Steponeplus real time pcr system, by Thermo Fisher Scientific (2 mentions)
Agilent rna 6000 nano kit, by Agilent Technologies (2 mentions)
Genechip wt terminal labeling and controls kit, by Thermo Fisher Scientific (2 mentions)
Ambion wt expression kit, by Thermo Fisher Scientific (2 mentions)
Trizol, by Thermo Fisher Scientific (2 mentions)
Epigallocatechin gallate (egcg), by Merck Group (2 mentions)
Ribopure kit, by Thermo Fisher Scientific (2 mentions)
Nanodrop system, by Thermo Fisher Scientific (2 mentions)
Agilent rna 6000 pico kit, by Agilent Technologies (2 mentions)
Magmax viral pathogenic nucleic acid isolation kit, by Thermo Fisher Scientific (2 mentions)
Taqman 2019 ncov control kit v1, by Thermo Fisher Scientific (2 mentions)
Quantstudio 5, by Thermo Fisher Scientific (2 mentions)
58 protocols using rnalater rna stabilization solution
1
Altitude Adaptation in Harvest Mice
2
Preserving and Barcoding Cnidarian Life Cycle
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
T. dohrnii colonies bearing medusa buds were collected in Otranto, Italy in July 2013. Individual colonies were kept isolated in glass bowls to collect newly released medusae. The colony and medusae were preserved separately in RNAlater RNA stabilization solution (ThermoFischer Scientific) and stored in -80C for further processing. In Bocas del Toro, Panama in July 2015, newly released medusae from polyps found in the field were isolated in glass bowls and starved to induce into cysts (24-48 hr). Cysts were preserved in RNAlater and stored in -80C for further processing. Some polyp tissue was preserved for DNA barcoding purposes. Prior to RNA extraction, total DNA was extracted from polyp tissue from both collections using a protocol provided by Miglietta and Lessios (2009) (link) (Miglietta and Lessios 2009 (link)). A fragment of the mitochondrial 16S gene was amplified and sequenced using forward SHA and reverse SHB primers [Forward (SHA): 5′-TCGACTGTTTACCAAAAACATAGC-3′, Reverse (SHB): 5′-ACGGAATGAACTCAAATCATGTAAG-3′] for DNA barcoding to ensure species identification (see (Miglietta and Lessios 2009 (link); Miglietta et al. 2018 ; Moura et al. 2011 (link); Schuchert 2014 (link))). The 16S sequences confirming species identification have been deposited in GenBank under the accession number KT984715 for the polyp/medusa and MH029858 for the cyst.
3
Tissue Biopsy and RNA Isolation
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
All human studies were approved by the Institutional Ethics Committee of Nanjing Medical University and performed after obtaining written informed consent. Study subjects were from the Department of Urology, First People’s Hospital of Lianyungang (Lianyungang, China) and Department of General Surgery, Jiangsu Provincial Hospital (Nanjing, China). Tissue biopsies intended for RNA isolation were stored in RNAlater RNA stabilization solution (AM7020, Thermo Fisher Scientific, Life Sciences, USA).
4
Thermal Injury and MRSA Biofilm RNA-Seq
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
N/TERT epidermal skin was collected from 4 treatment groups, namely: (1) untreated skin control; (2) burned skin control (skin thermally challenged at 100 °C for 4 s); (3) burned skin with MRSA biofilm (burned skin spotted with 2 × 106 CFU MRSA USA300-LAC for 24 h then treated with 30 µL water for 24 h); and (4) burned skin with MRSA biofilm and DJK-5 treatment (burned skin with 24 h MRSA USA300-LAC biofilm then treated with 30 μL of 0.4% DJK-5 for 24 h). Skin models were excised from the cell culture insert using a disposable scalpel (VWR, Radnor, PA, USA) and immediately submerged in 800 µL RNAlater RNA stabilization solution (ThermoFisher Scientific), stored at 4 °C overnight and then transferred to a −80 °C freezer until the RNA isolation could be performed. To harvest enough RNA for RNA-Seq analysis, three skin models with the same treatment were pooled into each sample before RNA extraction. Total RNA was extracted from four independent pooled samples per treatment group using the RNeasy Micro Kit (Qiagen) following the manufacturer’s protocol. For quality control, 1 µL of each sample was run on the Agilent 2100 Bioanalyzer using the Eukaryotic Total RNA Nano Chip (Agilent Technologies, Santa Clara, CA, USA).
5
Liver Tissue and Blood Sample Preparation
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Tumor tissue and surrounding non-tumor liver tissue samples were obtained from resected liver specimens immediately after surgery. Tissue samples were immersed into RNAlater® RNA Stabilization Solution (ThermoFisher Scientific, Vilnius, Lithuania) and stored at −80°C. Corresponding blood samples were obtained one week prior to surgery. Blood samples were allowed to coagulate for 15 min, and then centrifuged at 3500 rpm for 10 min. Obtained sera were stored at −80°C until extraction of RNA.
6
Cardiac Tissue Sampling in Tetralogy of Fallot
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
This study was reviewed and approved by the Institutional Research Ethics Committee of the Children's Hospital of Fudan University (2016‐56). Cardiac tissue samples were obtained from 53 patients with TOF from the Biobank of the Children's Hospital of Fudan University, Shanghai, China. The diagnosis of TOF was based on echocardiography carried out at our hospital. None of the patients included in the study had been diagnosed with extracardiac anomalies or had any common chromosomal anomalies, such as 22q11 microdeletion. Cardiac tissues were removed from the blocked right ventricular outflow tract during surgery. Thirteen normal cardiac tissues samples were acquired from the Department of Forensic Medicine, Fudan University, Shanghai, China. They died as a result of traffic accidents and had no abnormal cardiac structures at autopsy. All tissue samples for RNA extraction were maintained in RNAlater® RNA Stabilization Solution (Thermo Fisher Scientific) after surgery or autopsy and were stored at −80°C.
7
Quantitative Real-Time PCR Analysis of Cell Cycle Regulators
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Snap frozen tissues were preserved in RNAlater RNA stabilization solution (ThermoFisher). Total RNA was extracted from primary MEFs or kidney using TRIZOL reagent (Life Technologies), and 1.5 μg of RNA was subjected to the synthesis of complementary DNA (cDNA) using SuperScript VILO cDNA synthesis kit. qRT-PCR was performed in a StepOnePlus Real-Time PCR system using Platinum SYBR Green qPCR SuperMix-UDG (ThermoFisher). Target gene expression was calculated using the comparative CT method (ΔΔCT) and normalized to an internal control gene Actb (β-actin). Primers used are as follows: Cdkn1a (p21) forward: 5′-GTCAGGCTGGTCTGCCTCCG-3′; Cdkn1a (p21) reverse: 5′-CGGTCCCGTGGACAGTGAGCAG-3′; Cdkn2a (p16) forward: 5′-CCCAACGCCCCGAACT-3′; Cdkn2a (p16) reverse: 5′-GCAGAAGAGCTGCTACGTGAA-3′; Actb (β-actin) forward: 5′-GATGTATGAAGGCTTTGGTC-3′; Actb (β-actin) reverse: 5′-TGTGCACTTTTATTGGTCTC-3′.
8
qRT-PCR Analysis of Inflammatory Genes
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Snap-frozen tissues were preserved in RNAlater RNA stabilization solution (ThermoFisher). Total RNA was extracted from cells or tissues by using TRIZOL reagent (Life Technologies), and 1,500 ng of mRNA was subjected to synthesis of cDNA using SuperScript VILO cDNA synthesis kit. qRT-PCR was performed in a StepOnePlus Real-Time PCR system using Platinum SYBR Green qPCR SuperMix-UDG (ThermoFisher). Target gene expression was calculated using the comparative CT method (ΔΔCT) by normalizing to an internal control gene Actb (β-actin). Primers used are as follows: Ptgs2 (COX-2) forward: ACTCATAGGAGAGACTATCAAG; Ptgs2 (COX-2) reverse: GAGTGTGTTGAATTCAGAGG; Nfkbia (IκBα) forward: CAGAATTCACAGAGGATGAG; Nfkbia (IκBα) reverse: CATTCTTTTTGCCACTTTCC; Il1b (IL-1β) forward: GGATGATGATGATAACCTGC; Il1b (IL-1β) reverse: CATGGAGAATATCACTTGTTGG; Nos2 (iNOS) forward: TGAAATCCCTCCTGATCTTG; Nos2 (iNOS) reverse: CCATGTACCAACCATTGAAG; Tnf (TNF) forward: CTATGTCTCAGCCTCTTCTC; Tnf (TNF) reverse: CATTTGGGAACTTCTCATCC; Il6 (IL-6) forward: AAGAAATGATGGATGCTACC; Il6 (IL-6) reverse: GAGTTTCTGTATCTCTCTGAAG. Actb (β-actin) forward: GATGTATGAAGGCTTTGGTC; Actb (β-actin) reverse: TGTGCACTTTTATTGGTCTC.
9
Optimized Gene Expression Analysis
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
For gene expression analyses lesions at two different stages were sampled (see Figure 1a ). For each lesion, four tissue sections were sampled (Figure 1a ). Tissue sections were stored in 100 µl of RNAlater RNA Stabilization Solution (ThermoFisher Scientific, https://www.thermofisher.com ). Altogether, five independent experiments were performed, each comprising of approximately 20 plants per experimental group. For each experimental group, between five and 10 lesions from different plants were sampled (Table S2 ).
Standard gene expression analysis procedures were optimized for the analysis of small leaf sections. Fixed tissue sections were homogenized using Tissue Lyser (Qiagen,https://www.qiagen.com ), followed by RNA isolation using the RNeasy Plant Micro Kit (Qiagen), DNAse treatment, quality control and reverse transcription.
The expression of 23 genes involved in different steps of immune signaling (Figure1c ) was analyzed and normalized to the expression of two validated reference genes, COX and 18S, as described previously (Petek et al., 2014 ; for primer and probe information and full experimental details, see Table S3 ), to eliminate technical variability, including the effect of different quantities of RNA in tissue sections. The standard curve method was used for relative gene expression quantification using quantgenius (http://quantgenius.nib.si ; Baebler et al., 2017 ).
Standard gene expression analysis procedures were optimized for the analysis of small leaf sections. Fixed tissue sections were homogenized using Tissue Lyser (Qiagen,
The expression of 23 genes involved in different steps of immune signaling (Figure
10
Cryopreserved PBMC Transcriptome Analysis
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
An aliquot of frozen PBMCs were shipped from Aeras Rockville, MD, USA to Bergen, Norway for the dcRT-MLPA assay. The PBMCs were thawed at 37° C water bath and ~2 million cells (avg: 4.45, min: 0.2, max: 15.73, SD: 3.19) were immediately transferred into 1.7ml sterile RNase-free tubes containing 1ml of RNAlater®: RNA stabilization solution (ThermoFisher Scientific). Following incubation at room temperature for 1 hours, subsequently the samples were stored at -70°C for further analysis.
Total RNA was extracted from the PBMCs using the RNeasy Mini Kit (Qiagen, Hilden, Germany) with RNase free DNase on-column digestion (Qiagen, Hilden, Germany) according to the manufacturer’s instructions. The total RNA concentration and purity (A260/280 nm ratio) were measured using a Nanodrop spectrophotometer (Thermoscientific, Wilmington, Delaware, U.S.A).
Total RNA was extracted from the PBMCs using the RNeasy Mini Kit (Qiagen, Hilden, Germany) with RNase free DNase on-column digestion (Qiagen, Hilden, Germany) according to the manufacturer’s instructions. The total RNA concentration and purity (A260/280 nm ratio) were measured using a Nanodrop spectrophotometer (Thermoscientific, Wilmington, Delaware, U.S.A).
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!