Mirna real time pcr assay kit

The total RNA was extracted using Biozol reagent. The miRNA first-strand cDNA synthesis kit and miRNA Real-Time PCR Assay kit (aidlab, Beijing) were used to quantify the miRNA transcripts in our study following the manufacturer’s instructions. Each reaction sample was run in triplicate. The expression of U6 (F-CTCGCTTCGGCAGCACA, R-AACGCTTCACGAATTTGCGT) small nucleolar RNA was used as a control. All experiments were carried out in triplicate. The data were analyzed according to the comparative CT method (2^−ΔΔCt).

Total RNAs from human tissues or HOKs were harvested using TRIzol (Invitrogen, Waltham, MA). The PrimeScript RT Reagent Kit (TaKaRa, Dalian, China) was used to synthesize the first strand cDNAs. The SYBR Premix Ex Kit (TaKaRa) was selected to perform qPCR in a real-time PCR system (Roche480). For miRNAs analyses, the miRNA isolation Kit (QIAGEN, Hilden, Germany) was chosen to extract miRNAs from human samples or cells. The specific miRNA First-strand cDNA Synthesis Kit (Aidlab Biotechnologies, Beijing, China) and a miRNA real-time PCR Assay Kit (Aidlab Biotechnologies) were applied to carry out the first strand cDNAs synthesis and qPCR, respectively. The relative amounts of transcripts were calculated using the 2^-ΔΔCt formula. GAPDH or U6 were regarded as internal control for mRNA or miRNA examinations. The equal amount of exogenous cel-miR-39 was served as internal control for circulating miRNAs in human serum and saliva. The primers for qPCR were listed in Supplementary Table 2.

First, we extracted the RNA from the cultured cells and tissues using TRIzol reagent (Invitrogen, USA). Reverse transcriptase was used to produce the first-strand complementary DNA (Aidlab, China) according to the manufacturer's instructions. miRNA Real-Time PCR Assay kit was used to detect the expression level of miR-146b (Aidlab, China). Furthermore, U6 was chosen to be internal control. The primers used were as follows: U6:5’-CTCGCTTCGGCAGCACA-3’ (forward), 5’-AACGCTTCACGAATTTGCGT-3’ (reverse); miR-146b:5’-TGACCCATCCTGGGCCTCAA-3’ (forward), 5’-CCAGTGGGCAAGATGTGGGCC-3’ (reverse); PTEN:5’- TGGATTCGACTTAGACTTGACCT -3’ (forward), 5’- GCGGTGTCATAATGTCTCTCAG -3’ (reverse).

RNA was collected using RNeasy Mini Kit (QIAGEN). For mRNA quantification, the TruScript Reverse Transcriptase (#NGB-54440, Norgen Biotek, Canada) was used to reverse the total RNA to cDNA. Subsequently, RT-qPCR were performed by using real-time PCR 7500 (#4351104, Thermofisher, Singapore). For miRNA quantification, the miRNA first strand Cdna synthesis kit (PC4801, Aidlab Biotechnologies, China) was used to reverse the total RNA to cDNA. Real-time quantitative PCR was performed using the miRNA-Real Time PCR Assay kit (PC4901, Aidlab Biotechnologies, China). The primers (5’-3’) were: IL-1β F: ACTGAGGACGTTCACCGTCTA, R GTGGGTGAATCTTAACTGGTT; miR-146a-5p F: CTGAGAACTGAATTCCATGGGTT, R GTGCAGGGTCCGAGGT; GAPDH F: TCCACGGTAAGCGGCATATGCTCT, R GCGCATTACCACGAACTCCATTCA; U6 F: CTTGCATCCGCATCAGA, R AATGCATCATGAAGTTCCGA. The internal controls were GADPH and U6. Gene fold change was calculated by 2^−ΔΔCt [15 (link)].

Total RNAs or miRNAs from HOKs or participants were isolated by Trizol reagent (Invitrogen, cat: 15596026) or miRNA isolation Kit (QIAGEN, cat: 217004), respectively. The first strand cDNAs synthesis for mRNA or miRNA were performed with PrimeScript RT Reagent Kit (TaKaRa, cat: RR037B) or a specific miRNA First-strand cDNA Synthesis Kit (Aidlab Biotechnologies, cat: PC4801), respectively. Real-time PCRs were completed with a SYBR Premix Ex Kit (TaKaRa, cat: RR420L) or a miRNA Real-time PCR Assay Kit (Aidlab Biotechnologies, cat: PC4901) accordingly. Relative amount of transcripts of mRNAs was calculated by the 2^-ΔΔCt formula. GADPH and U6 were applied as internal control for mRNA testing and miRNA examination, respectively. For circulating miRNA samples, the same amount of exogenous cel-miR-39 was added before miRNA extraction and served as normalization. PCR primers were shown in Supplementary Table 2.