Psicheck2 dual luciferase reporter plasmid

Oligonucleotides corresponding to the predicted target site or antisense miRNA sequences were synthesized and included flanking XhoI and NotI restriction sites (Life Technologies). After annealing to respective antisense oligonucleotides, target fragments were double-digested with the appropriate restriction enzymes (New England Biolabs, Ipswich, MA, USA) and cloned into the 3′UTR of Renilla luciferase within the psi-Check2 dual luciferase reporter plasmid (Promega, Madison, WI, USA). 293T cells were plated at a concentration of 5,000 cells per well in 96-well plates and transfected the following day with 100 ng of psi-Check2 reporter plasmid and 50 nM of miRNA precursor per well using Lipofectamine 2000 as per manufacturer’s instructions (Life Technologies). Forty-eight hours following transfection luciferase levels were measured using a Dual Luciferase Reporter Kit (Promega). For analysis, target Renilla luciferase activity was normalized to control firefly luciferase values.

DNA fragments of the 3’ UTR of JAMA that host the predicted complementary sites of miR156a or the mutated sites were digested by NotI-HF and XhoI (New England Biolabs, Ipswich, MA, USA). The DNA fragments were then cloned downstream of the Renilla luciferase reporter gene in psiCHECK2 dual luciferase reporter plasmid (Promega, Madison, WI, USA). 293T cell lines were seeded in 96-well plates and co-transfected with luciferase reporters together with miR156a mimic or negative control. Cells were lyzed with Dual-Luciferase Reporter (Promega). The luciferase activities were measured 48 hours after transfection, according to the manufacturer’s instructions, using the Panomics Luminometer (Affymetrix, Santa Clara, CA, USA). Luciferase activity was normalized by Renilla luciferase activity. The sequences of PCR primers used for these clonings are included in S2 Table.

Human XIAP complementary DNA (cDNA) was obtained by RT-PCR of RNA prepared from MCF-7 cells, followed by amplification of the XIAP 3′UTR using a cDNA template and the following primers: forward, 5′-CTACTATAGAGTTAGAGGATCCTTAAG ACATAAAAATTTTTGCTTG-3′ and reverse, 5′-GA TATCTGCGGCCTAGCTAGCTGACGGACCGCGCCC GGTGTCTC-3′. The PCR products were subcloned into NheI- and BamHI-digested pIRESneo3-CMV Vector to obtain the construct XIAP 3′UTR, which was verified by DNA sequencing. The 3′UTR sequence of XIAP and FSCN1 were amplified from the genomic DNA of normal breast tissues and subcloned into the psiCHECK2 dual luciferase reporter plasmid (Promega, USA).

Reporter plasmids psiCHECK-2-SPRY2 and psiCHECK-2-HNF4α were constructed as described previously [28] . The 280-bp fragment of the SPRY2 3′-UTR containing the miR-21 target sequence was amplified from total DNA of primary rat HSCs by PCR and cloned into the psiCHECK-2 dual luciferase reporter plasmid (Promega, Madison, WI) at the 3′-end of the coding sequence of Renilla reniformis luciferase to produce psiCHECK-2-SPRY2. Similarly, the luciferase reporter plasmid psiCHECK-2-HNF4α containing a 280-bp fragment of the HNF4α 3′-UTR with the miR-21 target sequence was prepared. To determine sequence specificity, we also constructed the plasmids psiCHECK-2-mt-SPRY2 or psiCHECK-2-mt-HNF4α in which the conserved targeting sequence of miR-21 was mutated (from AUAAGCU to CUCGAGC). MiR-21 mimics and reporter plasmids were co-transfected into HEK-293 cells using Lipofectamine™ 2000. Renilla constructs were transfected as an internal control. After 48 h incubation, firefly luciferase and Renilla luciferase activities were measured using a luciferase assay system (Promega). All luciferase activity readings were normalized relative to the activity of the Renilla luciferase control. All experiments were performed in triplicate.