miRNA-enriched (200 bp) RNA fractions were isolated from ~100 mg of liver using mirVana RNA isolation kit according to the manufacturer’s instructions (Ambion, Austin, TX). Four μg were separated on 15% TBE urea gels (Bio-Rad), transferred to Hybond-N membranes (GE Healthcare), and then UV-cross-linked using a Stratalinker 2400 (Stratagene, La Jolla, CA). 5S probe (100 pmol) was labeled with digoxigenin (DIG) using a 2nd generation DIG oligonucleotide tailing kit (Roche, Indianapolis, IN). The probe was hybridized to membranes at 25 °C overnight in a hybridization oven after 2 hour of pre-hybridization at 60 °C. Three 2× SSC, 0.1% SDS washes were carried out for 10 min at room temperature followed by blocking and incubating with antibody against DIG. The signal was developed using CSPD (Roche) according to the manufacturer’s instructions.
Tbe urea gel
Manufactured by Bio-Rad
Sourced in Lao People's Democratic Republic, France
The TBE-urea gel is a type of polyacrylamide gel used for the separation and analysis of nucleic acid samples, particularly DNA and RNA. It utilizes a Tris-Borate-EDTA (TBE) buffer system and the addition of urea to denature the nucleic acid secondary structures, allowing for efficient and accurate size separation.
Automatically generated - may contain errors
Lab products found in correlation
Hybond, by Cytiva (4 mentions)
Cutsmart buffer, by New England Biolabs (4 mentions)
Sybr gold, by Thermo Fisher Scientific (4 mentions)
Trizol, by Thermo Fisher Scientific (3 mentions)
Hybond n membrane, by Cytiva (2 mentions)
Tnt t7 quick coupled transcription translation kit, by Promega (2 mentions)
Pb buffer, by Qiagen (2 mentions)
User enzyme, by New England Biolabs (2 mentions)
Amersham typhoon imager, by GE Healthcare (2 mentions)
Amersham typhoon, by Cytiva (2 mentions)
Imagequant, by Bio-Rad (2 mentions)
Pcr block set, by Bio-Rad (2 mentions)
Pcr block, by Bio-Rad (2 mentions)
Gel loading buffer 2, by Thermo Fisher Scientific (2 mentions)
Costar spin column, by Corning (2 mentions)
Hybond n membrane, by GE Healthcare (1 mentions)
Mirvana rna isolation kit, by Thermo Fisher Scientific (1 mentions)
Dig oligonucleotide tailing kit, by Roche (1 mentions)
Expresshyb hybridization solution, by Takara Bio (1 mentions)
Hiseq 2000, by Illumina (1 mentions)
25 protocols using tbe urea gel
1
Liver miRNA Isolation and Northern Blot
2
Quantifying miRNA Expression by Northern Blot
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Northern blot analysis was performed on the basis of the method that has been previously described, with some modifications (64 (link)). Twenty micrograms of total RNA was separated on 15% tris-borate EDTA (TBE)–urea gels (Bio-Rad, #4566055) and then transferred to a positively charged nylon membrane (Roche, #11209299001). The membrane was cross-linked twice with 254 nm of UV light at 120 mJ/cm2 using a CL-1000 UV cross-linker. After prehybridization with 10 ml of ExpressHyb hybridization solution (Clontech) for 40 min at 37°C, the membrane was hybridized overnight with 15 pmol of IRDye-labeled oligonucleotide probes [hsa-miR-17-5p (/5IRD700/ctacctgcactgtaagcactttg), hsa-let-7d-5p (/5IRD700/aactatgcaacctactacctct), RNU43 (/5IRD800/CAGCACACAGTTTCTGTCCGCCCGTC), and RNA5S1 (/5IRD800/cccaggcggtctcccatccaagtactaaccaggcccgaccc)] in 10 ml of ExpressHyb solution at 37°C. The membrane was washed twice with 2× SSC and 0.1% SDS and once with 1× SSC and 0.1% SDS (10 min at room temperature for each) and visualized using the Odyssey CLx Imaging System followed by quantification using Image Studio software.
3
Small RNA Isolation and Sequencing
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total small RNA was isolated from the parental NoDice(4-25) cells, or from NoDice(4-25) cells transfected with hDcr or dDcr1 plus Loqs-PB, using Trizol and RNAs ∼15–30 nt in length fractionated by PAGE on 15% TBE-Urea gels (Bio-Rad). Small RNA was electroeluted from the excised gel slice (Gel Eluter/Hoefer), and cloned as previously described (Whisnant et al. 2013 (link)). Adapter-ligated small RNAs were reverse transcribed using SuperScript III (Invitrogen), amplified using GoTaq Green PCR Master Mix (Promega) with the Tru-Seq 3′ indices (Illumina), and sequenced on an Illumina HiSeq 2000.
4
Quantifying Small Nuclear RNAs
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA from primary human adipocytes, primary human skeletal muscle cells, mouse adipose tissue, and mouse skeletal muscle tissue was extracted using Trizol (Thermo Fisher Scientific). RNA samples were separated on 10% or 15% TBE-urea gels (Bio-Rad Laboratories) according to the manufacturer’s instructions. Samples were transferred and cross-linked using ultraviolet light to a HyBond N+ nylon membrane, and blotted for Alu RNA, B2 RNA or 5.8S rRNA using biotinylated oligonucleotide probes. Blots were developed with the Thermo Pierce chemiluminescent nucleic acid detection kit (ThermoFisher Scientific).
5
In Vitro Synthesis and Characterization of crRNAs for LbCas12a
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
crRNAs were synthesized for in vitro cleavage experiments using the HiScribe T7 Quick High Yield RNA Synthesis Kit (New England Biolabs; NEB). Templates for in vitro transcription were generated by hybridizing a ssDNA oligo with the T7 promoter to another oligo with the complementary T7 promoter sequence fused to the LbCas12a repeat and spacer in annealing buffer. Approximately 1 μg template was added to the HiScribe reaction and incubated at 37°C for 16–18 h. Reactions were purified using the Qiagen miRNeasy kit and resulting concentrations were measured using Qubit RNA Broad Range Assay Kit (Thermo Fisher) and the Qubit Fluorometer (Invitrogen). Purified RNA was loaded onto TBE–urea gels (BioRad) and resolved by electrophoresis in TBE buffer with low range ssRNA ladder (NEB). Gels were post-stained with SYBR gold for 1 h at room temperature and imaged using BioRad Gel Doc EZ Imager.
6
Hydrazine-Induced tRNA Cleavage Analysis
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
2 μg small RNA was treated with 25 μl of ice-cold hydrazine buffer (10% hydrazine, 3M NaCl) on ice for 10 min to 4 h. Then RNA was precipitated by adding 225 μl of H2O, 25 μl of 3M sodium acetate, pH 5.5, and 0.75 ml of 100% ethanol. After centrifugation and washes, the RNA pellet was resuspended in 100 μl cleavage buffer (H2O:glacial acid:aniline = 7:3:1) and incubated at room temperature in the dark for 2 h. RNA was then ethanal precipitated and dissolved in H2O. RNA concentration was measured by Nanodrop. 500 ng of small RNA were mixed with 2× TBE-Urea loading buffer (Bio-Rad), denatured at 95°C for 5 min, placed on ice before loading. RNA samples were then separated by 15% TBE–urea gels (Bio-Rad) at 200 V for 1 h. After electrophoresis, RNAs were transferred onto nylon membrane. Membranes were then UV-crosslinked, pre-hybridized, and blotted with p32-radioactive probes against the 3′ end of indicated tRNAs. The following probes were used: ArgCCT: 5′-CACCCCAGATGGGACTCGAA; LeuCAG: 5′-GTCAGGAGTGGGATTCGAAC-3′; SerCGT: 5′-TCGAACCCAGGATCTCCTGT-3′; ThrAGT: 5′-TCGAACCCAGGATCTCCTGT-3′; mt-ThrTGT: 5′-TGTCCTTGGAAAAAGGTTTTC-3′; ValCAC: 5′-GTTTCCGCCCGGTTTCGAACC-3′. Band intensities were quantified using ImageJ.
7
Detecting 3' end 2'-O-methylation in piRNA
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
To determine the presence of 2’-O-methylation at the 3’end of piRNA, 50 μg of total RNA was purified from 10 week-old testes then treated with NaIO4 for 1 hour. After treatment RNA was precipitated at -20°C overnight then re-suspended with borate buffer (pH 9.5) for β-elimination treatment at 45°C 90 min [29 (link),77 (link)]. RNA was purified through a G25 column (GE Healthcare) to remove salts then loaded on 15% TBE Urea gels (Life technologies) and blotted onto a membrane via the xCell Blot Module (Invitrogen) according to the manufacturer’s protocol. Blots were prehybridized with the Dig easy Hyb buffer (Roche) for 2 hours and hybridized overnight at 42°C with a γP32-labelled piRNA1 oligo probe [47 (link)]. Membranes were washed with increasing stringency, 3XSSC/25mM NaH2PO4/5% SDS and 1xSSC/1%SDS, then exposed to phospho-imager screens prior to scanning on a Typhoon Trio (GE Healthcare).
For the quantitation of piRNA with 30 day old testes, total RNAs were isolated and size separated on 15% TBE Urea gels as described above, then the relative piRNA content calculated between wild type and Henmt1PIN/PIN samples using densitometry via the Image Lab image acquisition and analysis software (Bio-Rad). In brief this involved piRNA band (~30nt) was normalized to loading control 5s rRNA and 5.8srRNA bands.
For the quantitation of piRNA with 30 day old testes, total RNAs were isolated and size separated on 15% TBE Urea gels as described above, then the relative piRNA content calculated between wild type and Henmt1PIN/PIN samples using densitometry via the Image Lab image acquisition and analysis software (Bio-Rad). In brief this involved piRNA band (~30nt) was normalized to loading control 5s rRNA and 5.8srRNA bands.
8
AGO2-Mediated miRNA Cleavage Assay
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
AGO2 cleavage assay was performed as previously described by Gregory et al. (83 (link)) and the following modifications. Oligo RNAs were purchased from Integrated DNA Technologies (IDT): dme-let-7a-5p_guide (/5Phos/UGAGGUAGUAGGUUGUAUAGU), dme-let-7a-3p_passenger
(/5Phos/UAUACAAUGUGCUAGCUUUCU), and dme-let-7a_target (/5IRD700/UAUACAACCUACUACCUCAUU). miRNA duplex was prepared by mixing equal volumes of both dme-let-7a-5p_guide and dme-let-7a-3p_passenger oligos in annealing buffer [10 mM tris (pH 8), 50 mM NaCl, and 1 mM EDTA], incubating at 95°C for 3 min and cooling gradually to room temperature for 1 hour. Either 0.025 μg of rAGO2 (Active Motif, #31486) or rAGO2 in combination with increasing concentrations of affinity-purified Flag-INTS11 was preincubated with the 5 nM miRNA duplex in buffer containing 3.2 mM MgCl2, 1 mM adenosine triphosphate, 20 mM creatine phosphate, RNasin (0.2 U/μl), 20 mM tris-HCl (pH 8), 0.1 M KCl, and 10% glycerol for 30 min at 37°C. Then, 10 nM dme-let-7a_target was added, and the cleavage reaction was incubated for 90 min at 37°C and stopped by adding proteinase K for 30 min at room temperature. Samples were loaded onto a 15% TBE-urea gels (Bio-Rad, #4566055), visualized using the Odyssey CLx Imaging System, and quantified by Image Studio Lite (v5.2).
(/5Phos/UAUACAAUGUGCUAGCUUUCU), and dme-let-7a_target (/5IRD700/UAUACAACCUACUACCUCAUU). miRNA duplex was prepared by mixing equal volumes of both dme-let-7a-5p_guide and dme-let-7a-3p_passenger oligos in annealing buffer [10 mM tris (pH 8), 50 mM NaCl, and 1 mM EDTA], incubating at 95°C for 3 min and cooling gradually to room temperature for 1 hour. Either 0.025 μg of rAGO2 (Active Motif, #31486) or rAGO2 in combination with increasing concentrations of affinity-purified Flag-INTS11 was preincubated with the 5 nM miRNA duplex in buffer containing 3.2 mM MgCl2, 1 mM adenosine triphosphate, 20 mM creatine phosphate, RNasin (0.2 U/μl), 20 mM tris-HCl (pH 8), 0.1 M KCl, and 10% glycerol for 30 min at 37°C. Then, 10 nM dme-let-7a_target was added, and the cleavage reaction was incubated for 90 min at 37°C and stopped by adding proteinase K for 30 min at room temperature. Samples were loaded onto a 15% TBE-urea gels (Bio-Rad, #4566055), visualized using the Odyssey CLx Imaging System, and quantified by Image Studio Lite (v5.2).
9
Quantitative Northern Blot Analysis
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
293T cells were plated at 5.25 × 106 cells in 10-cm dishes and transfected with 20 µg of a Cas9/sgRNA expression plasmid using polyethylenimine. Cells were harvested 72-h post-transfection in TRIzol (Life Technologies). Total RNA was isolated and fractionated on a 10% TBE-Urea Gel (Bio-Rad) and then transferred to HyBond-N membrane (Amersham) and UV crosslinked (Stratalinker, Stratagene). Membranes were prehybridized in ExpressHyb (Clontech) and then incubated at 37°C with a 32P-end labeled oligonucleotide. Membranes were washed with 2X SSC/0.1% SDS at 37°C and subjected to autoradiography.
10
Deaminase Activity Assay with ssDNA
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Sequences of all ssDNA substrates are listed in the Supplementary Sequences. All Cy3-labelled substrates were obtained from Integrated DNA Technologies (IDT). Deaminases were expressed in vitro using the TNT T7 Quick Coupled Transcription/Translation Kit (Promega) according to the manufacturer's instructions using 1 μg of plasmid. Following protein expression, 5 μL of lysate was combined with 35 μL of ssDNA (1.8 μM) and USER enzyme (1 unit) in CutSmart buffer (New England Biolabs) (50 mM potassium acetate, 29 mM Tris-acetate, 10 mM magnesium acetate, 100 ug/mL BSA, pH 7.9) and incubated at 37 °C for 2 h. Cleaved U-containing substrates were resolved from full-length unmodified substrates on a 10% TBE-urea gel (Bio-Rad).
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!