Exscript rt pcr kit

Total RNA was isolated from 2 × 10⁶ target cells using the Trizol reagent (Invitrogen, Carlsbad, CA). cDNAs generated by reverse transcription were used for real-time PCR with the ExScript RT-PCR kit (TaKaRa, Kusatsu, Japan). The qPCR primers for HER2 are as follows: 5′-CCCATATGTCTCCCGCCTTC-3′ (sense) and 5′-GGTTTTCCCGGACATGGTCT-3′ (antisense). The qPCR primers for GAPDH are as follows: 5′- ACCCAGAAGACTGTGGATGG-3′ (sense) and 5′-TCTAGACGGCAGGTCAGGTC-3′ (antisense). All amplifications and detections were carried out in the LightCycler 480 system (Roche, Basel, Switzerland) using the LightCycler 480 SYBR Green I Master (Roche, Basel, Switzerland). The statistical analyses were performed using the 2^{−*#x0394;ΔCt} relative quantification method.

Total RNA was isolated from 2 × 10⁶ cells by using the Qiagen RNeasy Mini Kit. cDNAs were generated by reverse transcription and used for real-time PCR analysis with an ExScript RT-PCR kit (TaKaRa, Japan). The qPCR primers for STC1 were as follows: forward, 5′- AGCTGCCCAATCACTTCTCC -3′ and reverse, 5′- CTCATTGGTGCGTCTCCTGT -3′. The qPCR primers for GAPDH were as follows: forward, 5′- ACCCAGAA GACTGTGGATGG -3′ and reverse, 5′-TCTAGACGGCAGGTC AGGTC -3′. All amplifications and detections were carried out on a LightCycler 480 system (Roche, Basel, Switzerland). Statistical analyses were performed using the 2^–△△CT relative quantification method.

For analysis of messenger RNA (mRNA) expression, reverse-transcription of cDNA was conducted using the ExScript RT-PCR Kit (Takara, Tokyo). Quantitative real-time (qRT-PCR) assays was performed using a SYBR Premix Ex Taq Kit (Takara, Tokyo) and the ABI StepOne Real-Time PCR System (Applied Biosystems). Cycle conditions were as follows: polymerase activation at 95 °C for 1 min, 40 cycles of denaturing at 95 °C for 15 s, and annealing/extension at 60 °C for 30 s. The relative expression of ATR was normalized to the expression level of glyceraldehyde-3-phosphate dehydrogenase (GAPDH), calculated by the 2-ΔΔCT method. The primer sequences are listed in Supplementary Table S1.

Complementary DNA was synthesized from 50 ng/l total RNA using an ExScript RT-PCR Kit (Takara-Bio, Shiga, Japan). Primers were selected using the Perfect Real-Time Primer Support System (Takara-Bio). Real-time RT-PCR was performed using SYBR Premix Ex Taq (Takara-Bio) and an ABI 7900HT Sequence Detector System (Applied Biosystems; Foster City, CA). The amplification program consisted of initial denaturation at 95°C for 10 s, followed by 40 cycles of denaturation at 95°C for 10 s, and annealing and extension at 60°C for 30 s. Dissociation curves were plotted to determine the specificity of the PCR products. Relative cDNA concentrations were determined using standard curves generated from sequential 10-fold dilutions of cDNA synthesized from QPCR Human Reference Total RNA (Stratagene; La Jolla, CA). All results were normalized relative to 18S ribosomal protein as an internal control.

The total RNA was extracted from Nile tilapia liver samples using the Trizol method. After 0.1 g of liver sample had been thoroughly ground in liquid nitrogen, the total RNA was extracted according to the instructions for the RNAiso Plus (Takara, Dalian, China # 9109). After electrophoresis was performed to determine the RNA integrity, the OD260/OD280 values (1.8–2.0) of the RNA were determined and the concentration was calculated. An appropriate amount of RNA was reverse-transcribed to synthesize cDNA according to the Prime Script™ RT reagent kit (Takara, # RR047A) and stored at −80 °C for later use.
Here, qPCR was performed using the SYBR Green fluorescent dye method, following the instructions of the ExScript™ RT-PCR kit (Takara, Dalian, China). The total reaction system was 25 μL/12.5 μL of TB Green Premix Ex TaqII (Takara, # RR820A), 0.5 μL of upstream and downstream primers, 9.5 μL of RNase-free water and 2 μL of cDNA. The reaction process included 40 cycles, with each cycle proceeding as follows: 95 °C for 30 s; 95 °C for 5 s, 60 °C for 30 s and 72 °C for 30 s. The relative quantification of the mRNA levels was performed using β-actin as an internal reference and finally calculated using the 2^−ΔΔCt method [41 (link)]. The target-gene-specific primers are shown in Table 2.

Total RNA was isolated from tissues or cells using TRIzol reagent (Invitrogen, Carlsbad, CA, USA) and reverse transcribed into cDNA using an ExScript RT-PCR kit (TaKaRa, Otsu, Japan) according to the manufacturer's instructions. The qRT-PCR reactions were performed using an ABI7500 System (Applied Biosystems, Foster City, CA, USA) and SYBR Green PCR Master Mix (TaKaRa). ANRIL expression was measured using the following primers: forward, 5′-TGTACTTAACCACTGGACTACCTGCC-3′ and reverse, 5′-CATTCTGATTCAACAGCAGAGATCAAAG-3′. GAPDH expression was used as an internal control and was measured with the following primers: forward, 5′-GTCAACGGATTTGGTCTGTATT-3′ and reverse, 5′-AGTCTTCTGGGTGGCAGTGAT-3′. All assays were performed in triplicate. Statistical analyses of the results were performed using the 2^−ΔΔCt relative quantification method.