All the pathogenic variants detected in the patient samples were confirmed by Sanger or MLPA. In case of SNVs and indels, primers flanking each variant were designed, and the genomic region encompassing the variant was amplified by PCR. Details of primer sequences and PCR conditions are provided in Appendix 1 (Appendix 1, Appendix 2, Appendix 3, Appendix 4, and Appendix 5 are available as online supplementary information). The PCR products were purified using the Gene Jet PCR Purification Kit (Thermo Fisher), according to the manufacturer’s instructions. The purified PCR products were sequenced using both forward and reverse primers (which were used for the PCR amplification) using the BigDye® Terminator v3.1 kit (Life Technologies). The sequencing PCR products were purified and subsequently analyzed by the 3500DX Genetic Analyzer (Life Technologies), as described previously [15 (link)]. MLPA was performed with 50 ng of gDNA, according to manufacturer’s instructions, using the SALSA MLPA P047-RB1 kit (MRC-Holland, The Netherlands). Probe amplification products were run on the Genetic Analyzer 3500DX (Life Technologies). MLPA peak plots were visualized and normalized, and the dosage ratios were calculated using the Coffalyser.Net software (MRC-Holland, The Netherlands). A threshold ratio of >1.3 denotes duplication and a ratio of <0.7 denotes deletion.
3500 dx genetic analyzer
Manufactured by Thermo Fisher Scientific
Sourced in United States
The 3500 Dx Genetic Analyzer is a laboratory instrument designed for genetic analysis. It utilizes capillary electrophoresis technology to separate and detect fluorescently labeled DNA fragments. The instrument is capable of analyzing multiple samples simultaneously and providing data for genetic applications.
Automatically generated - may contain errors
Lab products found in correlation
Bigdye terminator v3.1 cycle sequencing kit, by Thermo Fisher Scientific (5 mentions)
Abi prism 3.1 big dye terminator chemistry, by Thermo Fisher Scientific (5 mentions)
Amplitaq gold kit, by Thermo Fisher Scientific (2 mentions)
Abi verity 96 thermal cycler, by Thermo Fisher Scientific (2 mentions)
Bigdye xterminator purification kit, by Thermo Fisher Scientific (2 mentions)
Qiaamp dna mini kit, by Qiagen (2 mentions)
Bigdye terminator v3.1 kit, by Thermo Fisher Scientific (2 mentions)
Genejet pcr purification kit, by Thermo Fisher Scientific (2 mentions)
Net software, by MRC-Holland (2 mentions)
Seqman software, by Technelysium (2 mentions)
Bigdye terminator v1.1 cycle sequencing kit, by Thermo Fisher Scientific (2 mentions)
Agencourt cleanseq, by Beckman Coulter (1 mentions)
Nucleoseq columns, by Macherey-Nagel (1 mentions)
Platinum taq dna polymerase kit, by Thermo Fisher Scientific (1 mentions)
Seqscape software v3, by Thermo Fisher Scientific (1 mentions)
Qiaamp viral rna mini kit, by Qiagen (1 mentions)
Exosap clean up kit, by Thermo Fisher Scientific (1 mentions)
High pure pcr product purification kit, by Roche (1 mentions)
Qiamp dna mini kit, by Qiagen (1 mentions)
Wizard sv gel and pcr clean up system, by Promega (1 mentions)
51 protocols using 3500 dx genetic analyzer
1
Variant Validation by Sanger Sequencing and MLPA
2
Analyzing TP53 Mutations in Patients
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
TP53 coding exons (2–11) and flanking regions were simultaneously amplified at the annealing temperature of 60 °C, with the AmpliTaq Gold kit (Applied Biosystems; Thermo Fisher Scientific, Inc., Waltham, MA, USA). Sequencing was performed on purified PCR products by using the BigDye® Terminator v.3.1 Cycle Sequencing kit (Thermo Fisher Scientific, Inc.) and run on the 3500 Dx Genetic Analyzer (Thermo Fisher Scientific, Waltham, MA, USA) after purification with Agencourt CleanSeq®—Beckman Coulter. Sequences were analyzed by Mutation Surveyor® Software v5.1.0 (SoftGenetics, LLC, State College, PA, USA). The analysis was carried out on all available tissues from Patient 2 (tumor, blood, buccal cells) and on blood DNA from Patient 1.
3
BRCA1/BRCA2 Large Rearrangements Detection
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
MLPA analysis was performed on peripheral blood, aiming to detect BRCA1/BRCA2 large rearrangements. The SALSA MLPA probemix P002 and SALSA MLPA probemix P009 (MRC Holland, Amsterdam, The Netherlands) kits were used for the evaluation of BRCA1 and BRCA2, respectively. The analysis was performed on the 3500Dx Genetic Analyzer (Thermo Fisher Scientific, Waltham, MA, USA) and the Coffalyser.Net tool (MRC Holland, Amsterdam, the Netherlands) was used for data analysis. The BRCA1 exon numbering used in this P002 BRCA1 probemix was the traditional exon numbering (exons 1a, 1b, 2, 3, and 5–24), wherein no exon 4 is present.
4
Genetic Analysis of GJB2 and GJB6
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Sanger method was employed to sequence the entire coding region of GJB2 gene (primers available upon request). In particular, DNA was analyzed on a 3500 Dx Genetic Analyzer (ThermoFisher, Waltham, MA, USA), using ABI PRISM 3.1 Big Dye terminator chemistry (ThermoFisher, Waltham, MA, USA) according to the manufacturer’s instructions. Subsequently, GJB6 deletions (i.e., D13S1830- D13S1854) were screened by multiplex PCR, as previously described [20 (link)].
5
Germline Variant Validation by Sanger Sequencing
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Sanger sequencing was performed on DNA extracted from non-neoplastic tissues to investigate if the variants detected by NGS were of germline origin or not. Oligonucleotides specific for each variant were designed and the corresponding DNA regions were amplified at the annealing temperature of 60 °C, with the AmpliTaq Gold kit (Applied Biosystems; Thermo Fisher Scientific, Inc., Waltham, MA, USA). Sequencing was performed on purified PCR products by using the BigDye® Terminator v.3.1 Cycle Sequencing kit (Thermo Fisher Scientific, Inc., Waltham, MA, USA) and run on the 3500 Dx Genetic Analyzer (Thermo Fisher Scientific Inc.) The obtained data were analyzed by Mutation Surveyor® Software v5.1.2 (SoftGenetics, LLC, State College, PA, USA).
6
Rapid Multiplex Detection of Meningitis/Encephalitis Pathogens from CSF
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total nucleic acids (DNA/RNA) were extracted from approximately 1 mL CSF specimens using the nucleic acid extraction kit (Ningbo Health Gene Technology, Ningbo, China) on the automated extraction workstation Smart LabAssist-16/32 (Taiwan Advanced Nanotech Inc, Taiwan), according to the manufacturer's instructions. The nucleic acid was subjected to multiplex amplification for all specimens using Meningitis/Encephalitis Pathogen Multiplex Detection Kit (Ningbo Health Gene Technology, Ningbo, China) on ABI Verity 96 Thermal Cycler (Thermo Fisher Scientific, Carlsbad, CA, USA). The PCR product was subjected to capillary electrophoresis and fragment analysis using a 3500Dx Genetic Analyzer (Thermo Fisher Scientific, Carlsbad, CA, USA) according to the manufacturer's protocol (Supplementary Figure S1 ). The procedure details had been reported previously (27 (link)). The panel was designed to detect 18 pathogens within 4 h.
7
Multiplex Respiratory Pathogen Detection
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The nucleic acids of each sample were subjected to multiplex amplification using a Respiratory Pathogen Multiplex Detection Kit (Ningbo Health Gene Technology, Ningbo, China) on an ABI Verity 96 Thermal Cycler (Thermo Fisher Scientific, Carlsbad, CA, USA). The PCR product was then subjected to capillary electrophoresis and fragment analysis using a 3500Dx Genetic Analyzer (Thermo Fisher Scientific, Carlsbad, CA, USA) according to the manufacturer’s protocol. The panel was specifically designed to detect 12 pathogens, namely, influenza A (H1N1) 2009 virus (09H1N1), seasonal H3N2 virus (H3N2), influenza B virus (InfB), human adenovirus (HADV), HBoV, human coronavirus (HCOV; 229E, OC43, NL63, HKU1), human metapneumovirus (HMPV), HPIV, HRV, human respiratory syncytial virus (HRSV), mycoplasma pneumonia (Mp) and chlamydia (Ch), within 4 h.
8
Sanger Sequencing of Viral 2C Region
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Viral genome was sequenced using the Sanger (population) method. Viral RNA was isolated from 140 µL of viral suspension with the QIAamp Viral RNA Mini Kit (Qiagen, Courtaboeuf, France) following the manufacturer’s instructions. The whole 2C region (from nt 4039 to nt 5025) was amplified using the Superscript III One-step reverse transcription-polymerase chain reaction (RT-PCR) system with Platinum Taq DNA polymerase kit (Thermo Fischer Scientific). The amplicons were checked on a 2% agarose gel, purified on Nucleoseq columns (Machery-Nagel, Hœrdt, France), and sequenced using the BigDye Terminator v3.1 Cycle Sequencing Kit (Thermo Fischer Scientific, Les Ulis, France). The sequences were purified with the BigDye XTerminator Purification Kit. Sequenced products were analyzed on a 3500Dx genetic analyzer (Thermo Fischer Scientific). Electrophoregrams were manually edited with Seqscape software v3 (Thermo Fischer Scientific). The sequences of primers are shown in Table 1 .
9
DNA Extraction and Sequencing Protocol
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
DNA was extracted by using QIAamp DNA Mini Kit (Qiagen). For sequencing, the BigDyeTM Terminator v3.1 sequencing kit (ThermoFischer, Waltham, MA, USA) was used, following the manufacturer’s protocol. Briefly, target sequence was amplified by PCR and then purified with the ExoSAP clean-up kit (ThermoFischer). The BigDye XTerminator™ purification kit was used for cleaning ahead of sequencing with a 3500DX Genetic Analyzer (ThermoFisher) and analyzing results with the Geneious prime 2019 software. Real-time PCR was performed using qPCRBIO SyGreen Mix kit from PCRBIOsystems. Following primers were used: CD44: Fwd: TCCAACACCTCCCAGTATGACA, Rev: GGCAGGTCTGTGACTGATGTACA and PAK1: Fwd: TTACGGGAATGCCAGAGCAG, Rev: CAGCCTGCGGGTTTTTCTTC.
10
Genetic Screening of BCHE, RNPEP, and RAPH1
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Blood samples were collected from two C5 adults, who signed informed consent to participate in the genetic study. Genomic DNA was extracted from peripheral blood leucocytes with the QIAamp Blood-DNA mini reagent kit (Qiagen, Courtaboeuf Cedex, France) according to the manufacturer’s instructions. DNA was eluted in 100 µL of water in the final step and stored at −20 °C until required. Sequencing of the coding exons and exon-intron boundaries of the BCHE (NM_000055.3), RNPEP (NM_001319183.1), and RAPH1 (NM_203365.3) genes was performed after PCR amplification of genomic DNA, with specific primers (list on request). PCR products were purified with use of the High Pure PCR Product Purification Kit (Roche Diagnostics, Mannheim, Germany) according to the manufacturer’s instructions. Both strands were sequenced using amplification primers as sequencing primers and BigDyeDeoxy terminator cycle sequencing according to the manufacturer’s instruction (Life Technologies, Aubin, France). Purified sequencing fragments were separated by capillary electrophoresis and detected by laser-induced fluorescence on a 3500 Dx Genetic Analyzer (Thermo Fisher Scientific, Villebon-sur-Yvette, France).
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!