The largest database of trusted experimental protocols

2 protocols using si fgd5 as1 2

1

Dissecting FGD5-AS1 and miR-103a-3p Interplay in GBM

Check if the same lab product or an alternative is used in the 5 most similar protocols
U251 and U87 cells were seeded in 24-well plates at a density of 1 × 105 cells/well and maintained for 24 h at 37°C. Small-interfering RNAs (siRNAs) targeting FGD5-AS1 (si-FGD5-AS1-1 and si-FGD5-AS1-2) and the corresponding negative control (si-NC) were obtained from GenePharma Co., Ltd (Shanghai, China). An overexpression plasmid of miR-103a-3p (miR-103a-3p) and negative control (miR-NC) as well as an miR-103a-3p inhibitor (miR inhibitor) and a negative control (inhibitor-NC) were obtained from GenePharma. U251 and U87 cells were infected with the oligonucleotides stated above using Lipofectamine 2000 (Invitrogen, Carlsbad, CA, USA). Cells without transfection were regarded as the blank group. To investigate the interaction between FGD5-AS1-1 and miR-103a-3p, U251 and U87 cells were co-transfected with si-FGD5-AS1 or si-NC and miR inhibitor or inhibitor-NC using Lipofectamine 2000.
pcDNA-TPD52 (TPD52) and negative control (pcDNA-NC) were purchased from GenePharma. To explore whether TPD52 was involved in the role of FGD5-AS1 in GBM, U251 cells were co-transfected with si-FGD5-AS1 or si-NC and pcDNA-NC or pcDNA-TPD52 using Lipofectamine 2000. Cells were analyzed after 48 h of transfection.
+ Open protocol
+ Expand
2

Overexpression and Silencing of FGD5-AS1 in Cells

Check if the same lab product or an alternative is used in the 5 most similar protocols
Gene Pharma synthesized the plasmids for overexpressing FGD5‐AS1, which were subsequently ligated into the pAd‐Flag vector. The specific sequence of the FGD5‐AS1‐overexpressing plasmid was obtained using the following primer: 5'‐CCTGACCTTTCGCCAACTGACT‐3'. For the negative control, plasmids without any target sequence were utilized, and the corresponding primer sequence was 5'‐GATTACAAGGACGACGATGACAAG‐3'. The specific small interfering RNA (siRNA) sequences targeting FGD5‐AS1, including si‐FGD5‐AS1 #1 and si‐FGD5‐AS1 #2, were synthesized by GenePharma. The sequences for si‐FGD5‐AS1 #1 and si‐FGD5‐AS1 #2 are as follows: si‐FGD5‐AS1 #1: 5'‐CAUUUGUAAUAGUGUUCAAUA‐3', si‐FGD5‐AS1 #2: 5'‐GCGUAGUUACAAUGAUUUAAA‐3'. siRNA targeting methyltransferase‐like 14 (METTL14) (si‐METTL14, 5'‐CCGACAGCATTGGTGCCGTGTTAAA‐3') and METTL3 (si‐METTL3, 5'‐GCACTTGGATCTACGGAAT‐3') was synthesized by RiboBio. In addition, a scrambled negative control siRNA (si‐NC) was synthesized by GenePharma for use as a control in the experiments. Transfection experiments were performed using Lipofectamine 3000 transfection reagent (Invitrogen).
+ Open protocol
+ Expand

About PubCompare

Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.

We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.

However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.

Ready to get started?

Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required

Sign up now

Revolutionizing how scientists
search and build protocols!