Transferred CD45.1+ P14 CD8+ T cells were sorted from the spleens or tumors of recipient mice following a gating strategy of CD8+CD44+CD45.1+CD45.2−Lin−Live/Dead dye−. Total RNA of sorted P14 cells was extracted from the sorted cells with a Micro Total RNA Isolation Kit (Thermo Fisher, AM1931) and reverse‐transcribed using RevertAid Minus First Strand cDNA Synthesis Kit (Thermo Scientific, K1632). Total RNA of the spleen or tumor tissue was extracted using TRIzol LS (Life Technologies) and reverse‐transcribed using RevertAid Minus First Strand cDNA Synthesis Kit. The relative expression levels of transcripts were determined using AceQ qPCR SYBR Green Master Mix (Vazyme, Q111) on a CFX96 Touch Real‐Time System (Bio‐Rad). The primers used in the study: Pdcd1 (forward: 5′‐ACCCTGGTCATTCACTTGGG‐3′; reverse: 5′‐CATTTGCTCCCTCTGACACTG‐3′), Havcr2 (forward: 5′‐TCAGGTCTTACCCTCAACTGTG‐3′; reverse: 5′‐GGCATTCTTACCAACCTCAAACA‐3′), Lag3 (forward: 5′‐CTGGGACTGCTTTGGGAAG‐3′; reverse: 5′‐GGTTGATGTTGCCAGATAACCC‐3′), Ctla4 (forward: ; reverse:), Tigit (forward: 5′‐CCACAGCAGGCACGATAGATA‐3′; reverse: 5′‐CATGCCACCCCAGGTCAAC‐3′), Cd244 (forward: 5′‐AGCCCTGGACTAATGGGACTT‐3′; reverse: 5′‐GCTGGCGTCAATCTGGTTCT‐3′), Klrc1 (forward: 5′‐GCCCCTGCAAAGGTTTTCC‐3′; reverse: 5′‐TCTGTGGGTTCTAGTCATTGAGG‐3′), and Hprt (forward: 5′‐TCAGTCAACGGGGGACATAAA‐3′; reverse: 5′‐GGGGCTGTACTGCTTAACCAG ‐3′).
Revertaid minus first strand cdna synthesis kit
Manufactured by Thermo Fisher Scientific
Sourced in United States
The RevertAid Minus First Strand cDNA Synthesis Kit is a product designed for the reverse transcription of RNA into complementary DNA (cDNA). The kit includes the necessary reagents and enzymes to perform this process.
Automatically generated - may contain errors
Lab products found in correlation
Aceq qpcr sybr green master mix, by Vazyme (2 mentions)
Cfx96 touch real time system, by Bio-Rad (2 mentions)
Rneasy plus mini kit, by Qiagen (2 mentions)
Rneasy mini kit, by Qiagen (2 mentions)
Gapdh, by Thermo Fisher Scientific (2 mentions)
Tianamp virus rna kit, by Tiangen Biotech (2 mentions)
Trizol ls reagent, by Thermo Fisher Scientific (2 mentions)
Cfx manager, by Bio-Rad (2 mentions)
Trizol ls, by Thermo Fisher Scientific (1 mentions)
Micro total rna isolation kit, by Thermo Fisher Scientific (1 mentions)
Trizol, by Thermo Fisher Scientific (1 mentions)
Maxima probe rox qpcr master mix, by Thermo Fisher Scientific (1 mentions)
Abi prism 7300, by Thermo Fisher Scientific (1 mentions)
Mgso4, by Merck Group (1 mentions)
Tricine, by Merck Group (1 mentions)
Wst 1, by Merck Group (1 mentions)
Qpcr primers, by Bio-Rad (1 mentions)
Mgco3, by Merck Group (1 mentions)
Ssoadvanced universal sybr green supermix, by Bio-Rad (1 mentions)
Dulbecco s modified eagle s medium dmem, by Merck Group (1 mentions)
15 protocols using revertaid minus first strand cdna synthesis kit
1
Profiling Exhaustion Markers in CD8+ T Cells
2
Quantification of Influenza Virus Replication
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Individual mice were weighted daily before and after PR8 infection until day 5. Following euthanasia, lungs were removed, weighted and homogenized in Trizol (Thermo Scientific) for RNA extraction. Extracted RNA was reverse transcribed with IAV segment 7 matrix protein 2 primer (5'-CATCCTGTTGTATATGAGGCCCAT-3') and Oligo dT using RevertAid Minus First Strand cDNA synthesis Kit (Thermo Scientific). Real-time PCR was performed with RealStar Green Power Mixture (Genestar). The viral titer is standardized with known quantity of PR8 virus stock. IAV segment 7 matrix protein 2 primers for real-time PCR are: forward-5'-GGACTGCAGCGTAGACGCTT-3', reverse-5'-CATCCTGTTGTATATGAGGCCCAT3'.
Chemokine receptor screening by RT-PCR RNA was extracted from sort-purified cells with Rneasy Plus Mini Kit (Qiagen) and was reverse-transcribed with RevertAid Minus First Strand cDNA synthesis Kit (Thermo Scientific). Real-time PCR was performed with RealStar Green Power Mixture (Genestar) on a 7500 Realtime PCR system (ABI). Primers used were listed in Table S4.
Chemokine receptor screening by RT-PCR RNA was extracted from sort-purified cells with Rneasy Plus Mini Kit (Qiagen) and was reverse-transcribed with RevertAid Minus First Strand cDNA synthesis Kit (Thermo Scientific). Real-time PCR was performed with RealStar Green Power Mixture (Genestar) on a 7500 Realtime PCR system (ABI). Primers used were listed in Table S4.
3
Quantification of NCL and SSTR2 mRNA
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA was harvested from adherent cells using the RNeasy Mini Kit (Qiagen, Copenhagen, Denmark) according to the instructions of the supplier. The RNA concentration was measured on the NanoDrop ND-1000 spectrophotometer (Thermo Fisher Scientific, Hvidovre, Denmark), and stored at -80°C until use. RNA was reverse transcribed using the RevertAid Minus First strand cDNA synthesis kit (Life Technologies, Nærum, Denmark) using 1 μg total RNA and oligo(dT) primers, following the instructions of the manufacturer. qRT-PCR was performed with Maxima® Probe/ROX qPCR Master Mix (Thermo Fisher Scientific) and taqman assays for NCL (Life Technologies, Hs01066668-m1) and SSTR2 (Life Technologies, Hs00265624_s1). 10 ng cDNA was used per reaction, as recommended by the providers’ protocols. ACTB (Life Technologies, Hs99999903-m1) and GAPDH (Life Technologies, Hs99999905-m1) were used as references for normalization. The qRT-PCR was performed in a ABI Prism 7300 (Thermo Fisher Scientific), for 2 min at 50°C, followed by 15 min at 95°C and 40 cycles at 95°C for 15 sec and 60°C for 1 min. Expression levels were analyzed using the Biogazelle qBaseplus software (www.qbaseplus.com ), and normalized to ACTB and GAPDH. Moreover, the expression levels were referred to a virtual common reference (REF), representing the mean expression level of the TP53 and the CDKN1A mRNA in MCF7 cells.
4
HeLa Cell Splice Correcting Oligonucleotide Assay
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
HeLa pLuc705 cells were grown at 37°C in a humidified incubator with 5% CO2 in Dulbecco’s modified Eagles Medium (DMEM) (Sigma Aldrich, Sweden), supplemented with 10% fetal bovine serum (FBS), 200 μg/ml streptomycin and 200U/ml penicillin (Invitrogen, Sweden). The ligands library was obtained from Selleck chemicals. For the delivery experiments and the luciferin assay buffer, PS-2′-OMe Splice correcting oligonucleotides (5′ -CCU CUU ACC UCA GUU ACA-3′) were purchased from Ribotask (Denmark) and D-Luciferin was purchased from Perkin-Elmer (Sweden). The RNA extraction was performed with RNeasy kit purchased from Qiagen. RevertAid Minus First Strand cDNA Synthesis kit was purchased from ThermoScientific. SsoAdvanced™ Universal SYBR® Green Supermix and qPCR primers were bought from Bio-rad (Sweden) (S2 Table ). LysoTracker Green DND-26 was purchased from Thermofisher scientific (Sweden). All other reagents, DSMO, MgCO3, MgSO4, Tricine, DTT, CoA, EDTA, WST-1, and ATP were obtained from Sigma-Aldrich (Sweden).
5
Optimized Molecular Techniques for Cell Signaling
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Coupling reagents and amino acids were bought from Iris Biotech, Germany. Rink-amide ChemMatrix resin was purchased from PCAS BioMatrix, Canada. PS-2′-OMe splice-correcting oligonucleotides (5′-CCU CUU ACC UCA GUU ACA-3′) were purchased from RiboTask, Denmark. Cell culture reagents were purchased from Gibco (Life Technologies). Cyto-ID autophagy detection kit was bought from Enzo Life Sciences, Sweden. RNA extraction has been performed with RNeasy Mini Kit purchased from Qiagen, Germany and RNA Clean & Concentrator purchased from Biosite, Sweden. cDNA samples were prepared using RevertAid Minus First Strand cDNA Synthesis Kit purchased from Thermo Scientific, Sweden. All PCR reagents (primers and dyes) were purchased from Biorad, Sweden. Pharmacological ligands (CCG 203971, PF 573228, Atorvastatin LDL, Prostaglandin E2, TLR-4-IN-C34, CH-223191, Wortmannin, Bafilomycin A (BAFA), Rapamycin (RAP), and Importazole were from Sigma-Aldrich (Stockholm, Sweden); (MHY1485, Alprenolol hydrochloride) was purchased from Tocris Bioscience, Sweden.
6
Quantifying LCMV Viral Loads
7
Comprehensive Gene Expression Analysis
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA was purified using the RNeasy Plus Mini Kit (Qiagen, Copenhagen, Denmark). The RNA concentration was measured by the Qubit RNA HS kit and the Qubit 4 Fluorometer (ThermoFisher Scientific) and stored at −80 °C until use. Two μg total RNA was reverse transcribed using the RevertAid Minus First strand cDNA synthesis kit (ThermoFisher Scientific) using oligo(dT) primers, following the manufacturer’s instructions. qPCR was performed with TaqMan Fast Advanced Master Mix TaqMan assays for SOX2 (Hs01053049_s1), NANOG (Hs04260366_g1), POU5F1 (Hs0099632_g1), CD44 (Hs01075864_m1), PROM1 (Hs01009250_m1), BAD (Hs00188930_m1), BAK1 (Hs00832876_g1), BAX (Hs00180269_m1), BCL2 (Hs00608023_m1), TP53 (Hs01034249_m1), CDKN1A (Hs00355782_m1), HPRT1 (Hs02800695_m1), and GAPDH (Hs99999905_m1), all from ThermoFisher Scientific. Ten ng cDNA was used per reaction, as recommended by the manufacturer’s protocols. The qPCR was performed in a QuantStudio 3 (ThermoFisher Scientific) for 2 min at 50 °C, 2 min at 95 °C, followed by 40 cycles at 95 °C for 1 sec and 60 °C for 20 s. Expression levels were normalized to HPRT1 and GAPDH, and relative expression levels were calculated using the Pfaffl-method [54 (link)].
8
CHIKV-Infected Macrophage RNA Extraction
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA from uninfected or CHIKV-infected MDMs was obtained using Direct-zol™ RNA Miniprep Plus (Zymo Research, Irvine, California) following the manufacturer’s protocol. RNA samples were treated with DNase I column (Zymo Research, Irvine, California) to remove contaminating genomic DNA. RNA was quantified by spectrophotometry (Thermo Scientific, Wilmington, DE, United States). cDNA libraries were constructed for each experimental group using the RevertAid Minus First Strand cDNA Synthesis Kit (Thermo Scientific), according to the manufacturer’s instructions. The samples were stored at −80°C. One μg of RNA was used for RNA-Seq, and 400 ng for cDNA synthesis.
9
Quantifying LCMV Viral Loads
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The viral loads of LCMV-Armstrong were titrated by plaque assay as previously described (28). For quantification of LCMV-Cl13 loads, the weight of harvested tissues from infected mice was measured. After homogenization, total RNA was then extracted from the tissue homogenate using TIANAMP Virus RNA Kit (TIANGEN, China) and was subjected to reverse transcription using the RevertAid Minus First Strand cDNA Synthesis Kit (Thermo, USA) following the manufacturer’s instructions, while LCMV-specific glycoprotein primer (GP-R: GCAACTGCTGTGTTCCCGAAAC) was used for cDNA synthesis. RT-qPCR with LCMV glycoprotein-specific primer pairs (GP-R, GCAACTGCTGTGTTCCCGAAAC, and GP-F CATTCACCTGGACTTTGTCAGACTC) was then used to evaluated viral loads in tissue samples. The Cq (quantification cycle) values from RNA samples of ten-fold serially diluted LCMV-Armstrong that had been previously titrated by plaque assay (28) was used to generate a standard curve. The pfu of LCMV-Cl13 in tissues was calculated according to the formula: lg(pfu)=slope*Cq+y-intercept; pfu/g=pfu calculated from above/tissue weight.
10
Comparative RNA Extraction and Profiling
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Passage 4 and 9 cells of each animal (n=3) grown in all six different media were seeded in triplicate at a density of 2×105 cells/cm2 in sterile six-well plates and grown until 70–80% confluence with media changed every 48 h. At the termination of the culture the spent media was discarded, and adhered cells were rinsed with 1X PBS, placing the plate on a −20°C cold gel pack and treated with 0.4 ml/well TRIzol® LS reagent (#10296028, Ambion™, Life Technologies, USA). The TRIzol-treated cell lysates from each well were harvested and stored at −80°C until use. Total RNA from the TRIzol-treated samples was extracted following the manufacturer's protocol. The total RNA yields and purity was determined by 260 and 280 nm absorbance using NanoDrop ND-2000 UV-Vis Spectrophotometer (Thermo Fisher Scientific, USA). The integrity of RNA in denatured samples was determined by 1% agarose gel electrophoresis in 0.2 ml 3-(N-morpholino) propane-sulfonic acid (MOPS) buffer (pH 7.0). Single-stranded cDNA from 4 µg total RNA was synthesized by reverse transcription (RT) using Revert Aid minus First Strand cDNA synthesis Kit (#K1621, Thermo Fisher Scientific) following the manufacturer's protocol.
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!