Bcip nbt

The cells were lysed in SDS sample buffer (50 mM Tris–HCl [pH 6.8], 2% SDS, 5% 2-mercaptoethanol, 0.1% bromophenol blue, and 10% glycerol), and the lysates were separated by SDS–polyacrylamide gel electrophoresis and blotted onto Immobilon polyvinylidene difluoride membrane (EMD Millipore). Each protein was visualized using primary antibodies, corresponding enzyme-conjugated secondary antibodies (HRP or AP), and the chemiluminescent ECL (GE Healthcare) or the chromogenic NBT/BCIP (Nacalai Tesque) substrates.

mRNA localization in the Ciona ovary was performed as previously [31 (link)]. In brief, cDNA fragments of CiEMa (KY21.Chr12.349) were obtained from Ciona ovaries using a primer pair (ACGCATTCCAGACAAATCTCAA and GCTCCAATGATCCTTTGCAGC) and cloned into the pCR™4-TOPO Vector (Thermo Fisher Scientific, Waltham, MA, USA). The sequence-confirmed vector was linearized using NotI or PmeI and used for digoxigenin (DIG) labeling (Roche, Basel, Switzerland). Adult Ciona ovaries were fixed overnight at 4 °C with 4% paraformaldehyde (PFA) in ASW; the fixative was exchanged with 30% sucrose, and the tissue was embedded in super cryoembedding medium (SCEM). Further, 10 μm cryosections were prepared and subjected to ISH as previously [31 (link)]. Specifically, hybridization was performed at 60 °C for 16 h in a hybridization buffer (50% formamide, 10 mM Tris-HCl, 1 mM EDTA, 0.6 M NaCl, 10% dextran sulfate, 1 × Denhardt’s solution, 0.25% SDS, and 0.2 mg/mL yeast transfer RNA). After washing and blocking of the slides, signals were developed using alkaline phosphatase-conjugated anti-DIG antibody (Roche, 1:5000) and NBT/BCIP (Nacalai Tesque, Inc., Kyoto, Japan) system. Three independent ovaries were examined. For the whole-mount experiment, two-week-old Ciona juveniles were fixed with 4% PFA and whole-mount ISH (WISH) was performed using the “InSitu Chip”, as previously described [26 (link)].

Evi1 mRNA in situ hybridization was carried out using a full length Evi1 cDNA probe [35] (link) using standard protocols. Probes were labeled using a DIG RNA Labeling Kit (Roche Applied Science, Tokyo, Japan). Detection was via an anti-DIG antibody coupled to alkaline phosphatase (Roche, Tokyo, Japan) followed by staining with BCIP-NBT (Bromo-4-chloro-3-indolyl Phosphate/Nitro Blue Tetrazolium) (Nacalai, Tokyo, Japan) as previously described [36] (link).