Genomic DNA was extracted from the peripheral blood of Schizophrenia patients and controls using QIAampR DNA Mini Kit (Qiagen, Valencia, CA, USA). TNF-α and TNF-β genes were amplified using an amplification refractory mutation system-PCR methodology to detect any polymorphism involved at positions −308 of TNF-α and +252 in intron 1 of TNF-β gene. PCR amplification was carried out using PuReTaq Ready-to-Go PCR Beads (GE Healthcare, Buckinghamshire, UK) as described elsewhere.32 (link) The molecular analysis of the samples was performed in the same laboratory and at the same time. The investigator was blind to the phenotype of the subjects at the time of molecular analysis. Later on, the results were separated for patient and control groups and analyzed for the determination of the frequencies of genotypes and alleles.
Qiaampr dna mini kit
Manufactured by Qiagen
Sourced in United States, Germany
The QIAampR DNA Mini Kit is a lab equipment product designed for the rapid and efficient purification of genomic DNA from a variety of sample types, including blood, tissue, and body fluids. The kit utilizes a silica-based membrane technology to capture and purify DNA, providing a reliable and consistent method for DNA extraction.
Automatically generated - may contain errors
Lab products found in correlation
Puretaq ready to go pcr bead, by GE Healthcare (1 mentions)
Ready to go pcr beads, by GE Healthcare (1 mentions)
Gel doc system, by Bio-Rad (1 mentions)
Ready to go pcr beads, by Cytiva (1 mentions)
3730xi dna analyzer, by Thermo Fisher Scientific (1 mentions)
Bigdye terminator v3.1 cycle sequencing kit, by Thermo Fisher Scientific (1 mentions)
Miseq machine, by Illumina (1 mentions)
Qubit 2.0 fluorometer, by Thermo Fisher Scientific (1 mentions)
Nanodrop 8000, by Thermo Fisher Scientific (1 mentions)
Nextera xt dna sample preparation kit, by Illumina (1 mentions)
7 protocols using qiaampr dna mini kit
1
Genotyping of TNF Polymorphisms in Schizophrenia
2
Genetic Polymorphisms in Oral Lichen Planus
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Genomic DNA was extracted from the peripheral blood of OLP patients and controls using the QIA ampR DNA mini kit (QIAGEN Hilden, North Rhine-Westphalia, Germany). TNF-α, TNF-β and IL-10 genes were amplified using amplification refractory mutation systems (ARMS)-PCR methodology21 to detect polymorphisms at positions -308 of TNF-α, +252 in intron1 of TNF-β and at loci -592, -819, and -1082 of IL-10 genes. PCR amplification was carried out using Ready to Go PCR Beads (GE Healthcare, Little Chalfont, Buckinghamshire, UK). Reactions consisted of 10 denaturation temperature cycles for 15 s at 94°C, annealing for 50 s at 65°C and extension for 40 s at 72°C. Then 25 denaturation cycles of 20 s at 94°C, annealing for 50 s at 59°C and then extension of 50 s at 72°C. Final extension was performed at 72°C for 7 min. A positive control was included in the PCR assay by amplification of the human growth hormone gene. The amplified products for the various samples were separated on the 1.5% agarose gel, stained with ethidium bromide and photographed.
3
Fungal DNA Isolation and Identification
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The DNA was isolated from fungal culture using the QIAampR DNA mini kit (Qiagen). Both quantity and quality of DNA were analyzed in 1% Agarose Tris Acetate EDTA gel. Forward primer-ITS1 (5′-TCCGTAGGTGAACCTGCGG-3′) and reverse primers-ITS4 (5′-TCCTCCGCTTATTGATATGC-3′) (Murthy, 2007 (link)) were used to amplify 18s rDNA by PCR. The reaction mixture (20 µl) set-up consists of 10 µl of master mix (Takara #RR310), 1 µl (10 pmol) each of both forward and reverse primers, 1 µl of template DNA and 7 µl of ddH2O. The PCR product was then loaded onto 1.0% agarose gel for electrophoresis and visualized under Gel doc system (Biorad). The amplicon 18s rDNA gene was sequenced using an automated ABI–DNA sequencer (Applied Biosystems 3500) at Centre for Plant Molecular Biology, Osmania University. BLAST was carried out with the NCBI Genbank database using the fungal 18s rDNA ITS gene sequence and deposited in Genbank/EMBL. Sequences were identified and matched based on maximum identity values using the multiple alignment tool Clustal W. MEGA10 was used to generate the phylogenetic tree. (Figure 1 ).
4
Genetic Polymorphism Analysis in Schizophrenia
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Genomic DNA was extracted from the blood of schizophrenia patients and controls using the QIAampRDNA mini kit (Qiagen, USA). IL-10 gene was amplified using amplification refractory mutation systems (ARMS)-PCR methodology[29 (link)] to detect any polymorphism involved at various loci viz:-592,-819, and -1082. The sets of primers used to amplify various types of polymorphism were as reported earlier.[30 (link)]
PCR amplification was carried out in Ready-To-Go PCR Beads (Amersham Biosciences, USA). Reaction consisted of 10 temperature cycles of denaturation for 15 s at 94°C, annealing for 50 s at 65°C, and extension for 40 s at 72°C. Then 25 cycles of denaturation for 20 s at 94°C, annealing for 50 s at 59°C, and extension for 50s at 72°C. Final extension was performed at 72°C for 7 min. A positive control was included in the PCR assay by amplification of the human growth hormones (HGH) gene. Electrophoresis of the PCR product was performed in 1.5% agarose gel, stained with ethidium bromide, and photographed.
PCR amplification was carried out in Ready-To-Go PCR Beads (Amersham Biosciences, USA). Reaction consisted of 10 temperature cycles of denaturation for 15 s at 94°C, annealing for 50 s at 65°C, and extension for 40 s at 72°C. Then 25 cycles of denaturation for 20 s at 94°C, annealing for 50 s at 59°C, and extension for 50s at 72°C. Final extension was performed at 72°C for 7 min. A positive control was included in the PCR assay by amplification of the human growth hormones (HGH) gene. Electrophoresis of the PCR product was performed in 1.5% agarose gel, stained with ethidium bromide, and photographed.
5
BDNF Val66Met Polymorphism Genotyping
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
DNA was extracted from the blood samples of each of the 49 participants according to standard laboratory protocols. DNA was isolated from peripheral blood mononuclear cells using the QIAamp (R) DNA Mini-Kit (QIAGEN, Tokyo, Japan). Genotyping was carried out with a polymerase chain reaction single nucleotide polymorphism (SNP) genotyping system using a BigDye Terminator v3.1 Cycle Sequencing Kit (Life Technologies Japan, Tokyo, Japan). The DNA was read using a BMG Applied Biosystem 3730xI DNA Analyzer (Life Technologies Japan, Tokyo, Japan). We used a forward primer (ATGAAGGCTGCCCCCATGAAA) and a reverse primer (TGACTACTGAGCATCACCCTG) for the BDNF Val66Met polymorphism. The participants were either homozygous for the Val allele (Val/Val genotype), heterozygous (Val/Met genotype), or homozygous for the Met allele (Met/Met genotype).
The 49 study subjects were divided into groups based on their BDNF genotype. Because the Met/Met genotype is less prevalent in Japan (about 15.9% (Shimizu, Hashimoto & Iyo, 2004 (link))), participants were grouped according to the occurrence of the Met allele, which resulted in two independent groups: Val homozygotes (Val/Val genotype) and Met carriers (Val/Met and Met/Met genotypes).
The 49 study subjects were divided into groups based on their BDNF genotype. Because the Met/Met genotype is less prevalent in Japan (about 15.9% (Shimizu, Hashimoto & Iyo, 2004 (link))), participants were grouped according to the occurrence of the Met allele, which resulted in two independent groups: Val homozygotes (Val/Val genotype) and Met carriers (Val/Met and Met/Met genotypes).
6
Whole-Genome Sequencing of E. coli Isolates from Meat Sources
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
A combination of cluster and simple random sampling were used to ensure that 14 isolates from the different meat sources and areas were chosen for WGS. A Genomic DNA (gDNA) of the E. coli isolates was extracted and purified using the QIAampR DNA Mini Kit (QIAGEN, Hilden, Germany). Following extraction, DNA quantification and the quality check was performed on a Qubit® 2.0 fluorometer (Life Technologies, Carlsbad, CA, USA) and Nanodrop 8000 (Thermo Scientific, Waltham, MA, USA), respectively [30 (link)]. The Nextera XT DNA Sample Preparation Kit was used to prepare the paired-end library and WGS was performed using the Illumina MiSeq machine (Illumina, San Diego, CA, USA). The obtained raw reads were de-novo assembled with the Shovill pipeline version 0.9.0 that uses SPAdes version 3.11.0. The assembled contigs were deposited in GenBank under project number PRJNA484345.
7
Lucanid-like Larval Species Identification
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
To identify the species of the lucanid-like larvae from Switzerland, DNA sequencing analysis was conducted on the adult females from France and one of the larvae. Insect DNA was extracted from muscles of the adult prothorax and larval head using a QIAamp (R) DNA Mini Kit (Qiagen) following manufacturer’s instructions. PCR was performed to amplify mitochondrial 16S ribosomal RNA gene with the primers, mt16SB and mt16SC (Hosoya and Araya 2005 (link)), and ITS2 region of the nucleus ribosomal RNA gene with the primers, 5.8S38F (5′-CGATGAAGAACGCAGCTAATTG-3′) and ITS4col (5′-TCCTCCGCTTAGTAATATGC-3′) (developed in this study). These PCR products were sequenced with mt16SA, mt16SB and mt16SC primers for mt16S, and 5.8S38F and ITS4col for ITS2 region.
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!