M 152

Capillary-Assisted Implantation Needles (CAIN) were created by pulling borosilicate thin wall with filament capillaries (GC100TF-10, Harvard Instruments) using a micropipette puller (Sutter Instruments, P-2000) with the following settings: Heat = 350, FIL = 4, VEL = 50, DEL = 225, PUL = 150. The tips of pulled needles were opened with jeweler’s forceps and then double-beveled using a MicroForge-Grinding Center (MFG-5, Harvard Instruments). Micromanipulation was achieved using a 3-axis micromanipulator (Narishige, M-152) with pressure control using a FemtoJet Express microinjection unit (Eppendorf). The VAMP (Vacuum-Assisted MicroProbe) was previously described (Takaki et al., 2013 (link)).
Larval zebrafish were anesthetized and implanted at 30 hpf in 0.252 g/L tricaine (Sigma, A5040) in a modified Schistosomula Wash medium (500 ml DMEM, 5 ml 1M HEPES and 2% antibiotic-antimycotic) to prevent egg hatching during implantation. Anesthetized larvae were grasped using the VAMP and an incision was made in the forebrain region using the CAIN. After making an incision, a single schistosome egg was picked up using the capillary action of the CAIN, and passed through the incision and deposited into the hindbrain ventricle (Video S1).

Cytoplasm containing a single Wolbachia strain from Drosophila melanogaster (either wMel provided by Luis Teixeira, wMelCS, or wMelPop provided by Francis M. Jiggins and Julien Martinez) was injected into the posterior end of dechorionated embryos of the uninfected D. nigrosparsa line nu_0 at Generation 0 using a micromanipulator (M‐152, Narishige) with a capillary (BF100‐78‐10, Sutter Instrument) attached to an inverted microscope (CKX53, Olympus). Injected embryos were placed on grape juice agar plates with fresh blobs of yeast and transferred into an incubator (MLR‐352H‐PE, Panasonic) for 2 days at 19°C. Injected embryos developed on malt food. Each surviving female adult was mated with an uninfected male from line nu_0 to generate infected fly lines, and each mating pair was kept separately in the mating cage. Three stably infected lines were generated, that is, ni_3, ni_6, and ni_8. To check for Wolbachia infection, five D. nigrosparsa females per line were randomly killed in each generation, and DNA was extracted and checked for infection by PCR using wsp81F and 691R primers.

The setup for electroablation is composed by a precision current stimulator (AM System, Model 2100; or Catalog #51595, Stoelting) that provides current pulses to a tungsten microelectrode (Catalog #UEWMGGSEBN1M, FHC Inc., Bowdoin, ME, USA) which is positioned with a micromanipulator (Narishige M-152) (see Figure 
1a). Larvae are visualized with a fluorescence microscope (AS LMD, Leica) equipped with 10x lens objective. For visualization at higher magnifications, objectives of longer focal distance are needed, in order to allow the entry and movement of the microelectrode between the objective and the sample. The stimulator allowed adjustment of current, and number and duration of current pulses. Tungsten microelectrodes were insulated with epoxylite, and its final 120 μm of length were tapered at an angle ranging from 10 to 15°, so that microelectrodes were less than 1 μm of diameter at the tip. Since microelectrodes are extremely narrow, they needed some preparation to be used with our micromanipulator. We sanded down the epoxylite from the thicker part of the microelectrode and then placed it in a needle (0.80 × 40 mm, Catalog #305167, BD). This allowed us to firmly adjust the microelectrode in the pipette holder of our micromanipulator.

Zebrafish embryos in E3 medium (5 mM NaCl, 0.17 mM KCL, 0.33 Mm CaCl₂ and 0.33 mM MgSO₄) were injected using a Picospritzer III microinjector (Parker Hannifin) and a mechanical micromanipulator (M-152; Narishige, Tokyo, Japan). Morpholinos were loaded in a pulled borosilicate glass filament-containing capillary (GC100F-15; Harvard Apparatus, Holliston). Typically 1 nL was injected in 1-cell-stage embryos, at room temperature. 2 ng of Ptenb and Ctl morpholinos and 1 ng of Ptena morpholinos were delivered per injection, as defects in development were too severe when 2 ng was used for Ptena. The sequences of the Morpholinos are: Ptena: CCTCGCTCACCCTTGACTGTGTATG; Ptenb: CTTTCGGACGGTCGGTCGTCTTTA. A Standard Control oligo from the company was used as control (Gene Tools,LLC, Philomath, OR, USA).

At 4 dpf, healthy larvae were injected at the pericardial site with PEG–PAMAM–Rho solutions of 5, 20, and 50 mg/mL (freshly prepared in 0.9% NaCl saline solution). As negative controls, non-injected animals and animals injected with vehicle (0.9% NaCl saline solution) were used. Larvae were anesthetized with 140 mg/L tricaine (MS222; ethyl-3-aminobenzoate methanesulfonate, #E10521, Sigma-Aldrich) [26 (link)] in E3 medium with PTU and positioned in custom-design channels molded in 3% (w/v) agarose in E3 medium (see details in Figure S1, Supplementary Material). Injection was performed by loading injection solutions in borosilicate glass capillaries (GB100F-10P, Science Products GmbH, Hofheim am Taunus, Germany). Capillaries were attached to the micromanipulator (M-152, Narishige, Setagaya, Japan) and injection controlled by a microinjector (IM 300 microinjector, Narishige, Setagaya, Japan). Injection pressure was adjusted to inject 2–5 nL of the tested solutions at the pericardial site. After injection, larvae were transferred to Petri dishes containing fresh E3 with or without PTU medium (for imaging or for behavioral tests, respectively) and incubated at 28 ± 0.5 °C until further analysis.