Amplified DNA fragments obtained from PCR assays (EGV1 and EGV2 rep genes, rbcL and matK partial genes—see below) were gel purified (using the SV Gel and PCR Clean-Up System from Promega) and inserted into pGEM®-T Easy vector (Promega) following the manufacturer’s protocol. The universal T7 and SP6 primers were used for sequencing. Sequence data of all the amplified fragments were obtained by single-pass double-stranded analysis (Beckman Coulter Genomics) using a primer walking approach when needed and was further assembled using DNAMAN for windows (Lynnon Corporation).
Sv gel and pcr clean up system
Manufactured by Promega
Sourced in United States
The SV Gel and PCR Clean-Up System is a product that provides a convenient method for purifying DNA fragments from agarose gels or for cleaning up PCR amplifications. It utilizes a silica-membrane technology to selectively bind DNA, allowing for the removal of unwanted materials such as primers, nucleotides, and salts.
Automatically generated - may contain errors
Lab products found in correlation
Pgem t easy vector, by Promega (2 mentions)
Rq1 dnase buffer, by Promega (1 mentions)
Rq1 dnase, by Promega (1 mentions)
Rneasy plant mini kit, by Qiagen (1 mentions)
Rnase a, by Qiagen (1 mentions)
Phusion master mix, by Thermo Fisher Scientific (1 mentions)
Zero blunt topo pcr cloning kit for sequencing, by Thermo Fisher Scientific (1 mentions)
Sanger sequencing, by Thermo Fisher Scientific (1 mentions)
Dnase, by Promega (1 mentions)
Pcr buffer, by Thermo Fisher Scientific (1 mentions)
Taq dna polymerase, by Thermo Fisher Scientific (1 mentions)
Chemidoctm imaging system, by Bio-Rad (1 mentions)
Primescript rt pcr kit, by Takara Bio (1 mentions)
Rneasy mini kit, by Qiagen (1 mentions)
Rtaq polymerase, by Takara Bio (1 mentions)
Phusion hot start high fidelity dna polymerase, by Thermo Fisher Scientific (1 mentions)
Wizard plus sv minipreps dna purification system, by Promega (1 mentions)
Wizard genomic dna purification kit, by Promega (1 mentions)
Mastercycler nexus, by Eppendorf (1 mentions)
Applied biosystems 3500xl genetic analyzer, by Thermo Fisher Scientific (1 mentions)
13 protocols using sv gel and pcr clean up system
1
Cloning and Sequencing of Amplified Genes
2
Viral particle purification and sequencing
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Partial purification of potential viral particles from D.alata acc. 313 leaf samples was performed as described previously (Jones et al. 2001 ). Pellets were resuspended in 150 µl of 1X RQ1 DNase buffer (Promega), which was then treated with 15 U of RQ1 DNase (Promega) and 10.5 U of RNase A (Qiagen) at 37°C for 2 h to digest non-particle-protected nucleic acids. RNA was extracted with an RNeasy Plant Mini Kit (Qiagen). Random RT-polymerase chain reaction (PCR) amplification was then performed with the TransPlex® Whole Transcriptome Amplification (Sigma-Aldrich) kit according to the manufacturer’s protocol. Potential RNA and DNA virus genome amplicons ranging in size from 200 to 1,000 bp were gel purified (SV Gel and PCR Clean-Up System (Promega)) and inserted into pGEM®-T Easy vector as recommended by the manufacturer (Promega). The inserts were amplified by PCR using the universal primers T7 and SP6, and fragments >250 bp were sequenced by single-pass double-stranded analysis (Cogenics) using the same primers. Sequence similarity searches were performed using BlastN and BlastX methods (Altschul et al. 1990 (link)).
3
Comprehensive 3'RACE of ABCC1 Transcripts
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
For 3′RACE the total RNA was DNase treated (Promega, WI) and oligo(dT25)T7 primers were used for reverse transcription. The 3′RACE reactions were performed using Phusion master Mix (ThermoFisher Scientific) and reverse primers as previously described40 . To simultaneously detect all forms of ABCC1 3′UTRs, we used the nested primers within the open reading frame of ABCC1. The sequence of the forward primer used for the first round of PCR was 5′-GACCTCCGCTTCAAGATCAC-3′ and for the second PCR was 5′-GAATGAACCTGGACCCATTCA-3′. After gel purification using the gel extraction wizard SV gel and PCR cleanup system (Promega), the second round PCR products were cloned using Zero Blunt TOPO PCR Cloning Kit for Sequencing (Life Technologies) and verified by Sanger sequencing (Lonestar Labs).
4
16S rRNA Gene Amplification and Sequencing
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Example 8
Small-subunit ribosomal genes (16S) will be amplified using universal 515F (5′-GTGCCAGCMGCCGCGGTAA-3′; SEQ ID NO:8) and 1391R (5′GACGGGCGGTGWGTRCA-3′) primers for bacterial 16S rRNA genes. The PCR reaction will contained 1×PCR Buffer from Invitrogen, 2.5 mM MgCl2, 0.2 μM of each primer, 0.2 μM dNTPs, 0.5 U Taq DNA polymerase by Invitrogen™ and 1.0 μl template DNA. Amplification will be accomplished by initial denaturation at 94° C. for 3 minutes followed by 25 cycles of 94° C. for 30 seconds, 50° C. for 30 seconds and 72° C. for 30 seconds with a final extension at 72° C. for 10 minutes. Each DNA sample will be amplified in triplicate and the amplicons will be pooled by plot and run on a 1.5% agarose gel. The bands will be purified using the Promega™ Wizard® SV Gel and PCR Clean-Up System. The sample will be then ready for sequencing.
5
Molecular Analysis of APP and MAPT Genes
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
In the molecular analysis of the APP and MAPT genes, total RNA was extracted from frozen brain tissue using the RNeasy Mini Kit (Qiagen, Valencia, CA). Extracted total RNA was used to synthesize cDNA (Prime Script RT-PCR kit, TaKaRa). Purified cDNA was used for subsequent PCR. Gene-specific primers, listed in Additional file 1 : Table S1, were used. PCR was performed as follows: 35 cycles at 98 °C for 10 s and 60 °C for 30 s. PCR products were electrophoresed on an agarose gel and analyzed using a ChemiDocTM imaging system (Bio-Rad Laboratories). Target amplification products were extracted from gel bands using a SV Gel and PCR Clean-Up System (Promega, Madison, WI) and subjected to a sequence analysis (FASMAC, Toyama, Japan). Multiple sequence alignment was performed using CLUSTALW (Kyoto University, Kyoto, Japan).
6
PCR Detection of Antibiotic Resistance Genes
7
Cloning and Sequencing the LUC2 Gene
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The LUC2 gene was polymerase chain reaction (PCR)-amplified from the pGL4.10 plasmid by using Phusion Hot Start High-Fidelity DNA Polymerase (Thermo Fisher Scientific, Waltham, MA, USA) in accordance with the instructions of the manufacturer. The primers sequences were as follows: forward primer: CATCAGCCAGCCCACCGTCG and reverse primer: CGGTCGAAGCTCTCGGGCAC.
The PCR products were purified with the SV gel and PCR clean-up system (Promega, Nacka, Sweden) and ligated into the retroviral vector pBABEpuro, which was pre-digested with the SnaBI (blunt) restriction enzyme. The plasmid was then transformed into DH5α cells. Positive clones were identified by purifying the vector by using a Wizard® Plus SV Minipreps DNA Purification System (Promega) in accordance with the instructions of the manufacturer. After purification, the plasmid was linearized and analyzed on a 0.5 % agarose gel for 90 min at 70 V. Finally, the inserts were confirmed by sequencing.
The PCR products were purified with the SV gel and PCR clean-up system (Promega, Nacka, Sweden) and ligated into the retroviral vector pBABEpuro, which was pre-digested with the SnaBI (blunt) restriction enzyme. The plasmid was then transformed into DH5α cells. Positive clones were identified by purifying the vector by using a Wizard® Plus SV Minipreps DNA Purification System (Promega) in accordance with the instructions of the manufacturer. After purification, the plasmid was linearized and analyzed on a 0.5 % agarose gel for 90 min at 70 V. Finally, the inserts were confirmed by sequencing.
8
Capillariid Genomic DNA Extraction and 18S rDNA Amplification
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
DNA of 2 male and 10 female capillariid specimens from both sampling sites, kept in 70 % alcohol, was extracted using a Promega Wizard® Genomic DNA Purification Kit according to the manufacturer's instructions. The PCR amplification of overlapping 18S ribosomal RNA gene (18S rDNA) segments was performed using different primer combinations of forward and reverse universal eukaryotic primers as previously described by Sato et al. (2010) and Tamaru et al. (2015) : (1) NSF4/18 and 18S-1192R/20, (2) NSF4/18 and NSR1438/20, (3) NSF573/19 and NSR1787/18, and (4) NSF573/19 and SSU18R. The DNA polymerase used was GoTaq® Green Master Mix following the manufacturer's instructions and PCRs in 20-25-μl reaction solution were conducted in a thermal cycler Eppendorf AG (Mastercycler® Nexus) using the following cycling protocol: 2 min at 94 °C, then 40 cycles at 94 °C for 30 s, 64 or 62 °C for 30 s, and 72 °C for 90 s, followed by a final extension at 72 °C for 7 min. The PCR products were purified using a Promega Wizard® SV Gel and PCR Clean-Up System; and sequenced by Macrogen Inc. (Seoul, Korea) directly with the primers for amplification. The nucleotide sequences reported in the present study are available from the DDBJ/EMBL/GenBank databases under the accession numbers MT068208, and MT068209.
9
Amplification and Sequencing of FAD2 Gene
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Reverse transcription (RT) polymerase chain reaction (PCR) amplification was conducted using RT-PCR (Platinum Green Hot Start PCR 2× Master Mix, InvitrogenTM, Thermo Fisher Scientific, USA) and a pair of sense and antisense degenerate oligonucleotides, designed based on the conserved nucleotide region of known FAD2 sequences. Polymerase chain reaction was performed using an initial denaturation step at 94°C for 2 minutes, followed by 35 cycles at 94°C for 30 seconds, 55°C for 30 seconds, and 72°C for 1 minute, and a final extension at 72°C for 5 minutes. Several FAD2 primers were designated as follows: F10 forward primer (5′-ATGGGWGCYGGTGGYAGAATGTCWG-3′), F15 reverse primer (5′-KATARTGYGGCATTGTWGARAAC-3′), and F12 forward primer (5′-CCTTAYTTTTCATGGAAACCAYAGC-3′). The amplicons obtained from the previous PCR were then migrated using 2% agarose gel electrophoresis and subsequently purified using Promega Wizard® SV Gel and PCR Clean-Up System (DNA Purification by Centrifugation). Finally, the purified DNA fragments were subjected to sequencing analysis.
10
Mouse Genomic DNA Extraction and Sequencing
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Genomic DNA was extracted from F0 mice. PCR was performed using Taq DNA polymerase (Greiner). The primer sequences were as follows: RegKO-S 5’-CCACCATCCTTAACTGGATC-3′; RegKO-AS 5’-CTAGAGTCCATGCCAAGCAC -3′. The PCR products were purified using SV Gel and PCR Clean-Up System (Promega). The purified PCR product were sequenced using BigDye Terminator v3.1 Cycle Sequencing Kit (Thermo Fisher Scientific) through Applied Biosystems 3500xL Genetic Analyzer (Thermo Fisher Scientific).
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!