To modulate AMPK α1 expression in vitro, lentiviruses, including LV-PRKAA1-RNAi (expressing a short interfering RNA targeting the PRKAA1 gene; 5′-CTTTGCTTCTCTTATAAGTTATTGTGA-3′), LV-PRKAA1 (a lentivirus overexpressing the PRKAA1 gene), and a negative LV-control were purchased from Shanghai GeneChem Co., Ltd. (Shanghai, China). A549 cells were infected with lentivirus according to the manufacturer's protocol. Briefly, 5×104 cells supplemented with lentivirus (multiplicity of infection, 10) and 1 µl Polybrene (Shanghai GeneChem Co., Ltd.) were grown on 24-well plates. The supernatant was removed after 24 h and fresh culture medium was added to the cells. Fluorescence microscopy was used to observe the infection rate 72 h postinfection, and stable clones were selected after 2 weeks using puromycin (2 µg/ml) (GE Healthcare Life Sciences, Little Chalfont, UK). Western blotting was conducted to confirm the final infection efficiency.
Puromycin
Manufactured by GE Healthcare
Sourced in United Kingdom
Puromycin is a lab equipment product used in cell culture and molecular biology applications. It functions as a selective agent, enabling the isolation of cells that have successfully incorporated genetic elements of interest.
Automatically generated - may contain errors
Lab products found in correlation
Lv prkaa1 rnai, by Genechem (2 mentions)
Lv prkaa1, by Genechem (2 mentions)
Polybrene, by Genechem (2 mentions)
Anti e cadherin ab1416, by Abcam (1 mentions)
Sulfo nhs lc biotin, by Thermo Fisher Scientific (1 mentions)
Btt 3033, by Bio-Techne (1 mentions)
Ml141, by Bio-Techne (1 mentions)
Incell6000 confocal microscope, by GE Healthcare (1 mentions)
12 well plate, by Corning (1 mentions)
Polybrene, by Merck Group (1 mentions)
Puromycin, by Merck Group (1 mentions)
Lentivirus, by Genechem (1 mentions)
Streptomycin, by Merck Group (1 mentions)
Penicillin, by Merck Group (1 mentions)
Glutamine, by Merck Group (1 mentions)
Blasticidin, by GE Healthcare (1 mentions)
8 protocols using puromycin
1
Modulating AMPK α1 Expression In Vitro
2
Integrin Signaling Antibody Protocol
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Anti-α2-integrin (sc-74466), anti-β-Catenin (sc-59737) and anti-RhoGDI (sc-373724) antibodies were from Santa Cruz Biotechnology. Anti-β1-integrin (AB1952), anti-active-β1-integrin (12G10), anti-α3-integrin (MAB2290), anti-p-Src (Y418; 07-909), anti-Src (GD11), anti-GAPDH (MAB374) and anti-GFP (MAB1083) antibodies were from Merck. Anti-p-Shp2 (Y542; 3751) and Shp2 (3752) antibodies were from cell signalling. Anti-E-cadherin (ab1416) and anti-laminin-β1 (ab44941) antibodies were from Abcam. Anti-vinculin (hVIN-1), anti-phosphotyrosine (4G10) and anti-HSC-70 (N69) antibodies were from Sigma-Aldrich. Anti-α4 integrin (MAB1354) was from R&D Systems. Anti-α5-integrin (eBioSAM-1) antibody was from eBioscience. Anti-p-RhoGDI (Y156; OAA100735) antibody was from Aviva Systems Biology. Anti-laminin-α3 (MAB21441) was from Novus Biologicals. Anti-Cdc42 (ACD03) antibody was from cytoskeleton. Anti-mouse horseradish peroxidase (HRP) and anti-rabbit HRP were from Dako. Anti-mouse Alexa 488 and Alexa 568, anti-rabbit Alexa 488 and Alexa 568, Sulfo-NHS-LC-biotin and phalloidin Alexa 647 were all obtained from Thermofisher. BTT-3033, PP2 and ML141 were from Tocris/Biotechne (Bristol, UK); shp099 was from Millipore. α2-integrin and control shRNA vectors were from Sigma-Aldrich. Calyculin A and protease inhibitor cocktail 1 were obtained from Calbiochem. Puromycin was obtained from GE Healthcare.
3
Lentiviral Transduction of IBD Candidates
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Proliferative HT-29 cells at 50% confluency in 12-well plate (Corning) were transduced in triplicate with viral stock at a multiplicity of infection (MOI) of 40-100 with 8 μg/ml of polybrene (Sigma, Cat: H-9268). Twenty-four hours post-transduction, media was changed and 3 μg/ml puromycin (Millipore Sigma) was added. After 3 days of puromycin selection, the percentage of eGFP-expressing cells/colonies were counted using an IN Cell 6000 confocal microscope (GE Healthcare, Marlborough, MA) and any well presenting less than 5% green fluorescent protein (GFP) positive cells was eliminated. The appearance and confluence of the cultures were recorded daily, and cells were grown for an average of 8 days (with a range of 5–27 days) to select successfully transduced cells and reach confluence before RNA extraction. Transduction of the whole set of IBD gene candidate ORFs was performed in batches of about 15 ORFs, each done in triplicate, and including an empty vector control. Some ORFs were repeated between batches for quality control and validation purposes. A total of 12 ORFs failed to transduce into HT-29 cells and were dropped from the analysis.
4
Modulating AMPK α1 Expression in A549 Cells
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
To modulate AMPK α1 expression levels in A549 cells, lentiviruses, including LV-PRKAA1-RNAi (expressing a short interfering RNA targeting the PRKAA1 gene), LV-PRKAA1 (a lentivirus overexpressing the PRKAA1 gene), and a negative LV-control were purchased from Shanghai GeneChem Co., Ltd. (Shanghai, China). According to the manufacturer’s instructions, 5.0×104 cells supplemented with 1ul lentivirus and 1ul Polybrene (GENECHEM Co., Ltd, Shanghai, China) were grown on 24-well plates. 24 hours later, the supernatant was removed and fresh culture medium was added to the cells. Fluorescence microscopy was used to observe the infection rate at 72 hours post-infection, and stable clones were selected after 2 weeks using puromycin (2 µg/mL) (GE Healthcare Life Sciences, Little Chalfont, UK). The final infection efficiency was confirmed by Western blot.
5
Mammosphere Characterization and Genetic Manipulation
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Passage 1 mammospheres (F1) were collected, disgregated and single cell suspensions infected with PEG (System Biosciences)-concentrated lentivirus particles containing the following shRNAs (Open Byosystem): Scramble: ccggCAACAAGATGAAGAGCACCAACTCGAGTTGGT-GCTCTTCATCTTGTTGtttttg shRNA Prep1.1 : ccggCCCTACAACAGGGAAATGTAACTCGAGTTA-CATTTCCCTGTTGTAGGGtttttg shRNA Prep1.2 : ccggGCTTCAAGTCAACAACTGGTTCTCGAGAACCAGTT-GTTGACTTGAAGCtttttg shRNA Prep1.3 : ccggGCTATCAAGATGGACAGCAAACTCGAGTTTGCTGTC-CATCTTGATAGCtttttg shRNA Prep1.4 : ccggGCCATTTATAGGCATCCACTACTCGAGTAGTGGAT-GCCTATAAATGGCtttttg Infected cells were puromycin (PAA Laboratories)-selected and either plated for in-vitro SFE (Sphere Forming Efficiency) and branching morphogenesys or for protein and RNA extraction.
6
Breast Cancer Cell Line Knockdown
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The human breast cancer cell lines SKBR3, AU565 and HCC1954 were kindly provided by Wirtz (Stratifyer GmbH, Köln, Germany). The cell lines T47D and MDA-MB-231, MDA-MB-231SA and MDA-MB-231-Brain were a generous gift from Professor Harriet Wikman–Kocher (Institute of Tumour Biology, University Medical Center Hamburg, Eppendorf, Hamburg) and Dr Takara (University of Texas), respectively. All cell lines were cultured under standard conditions in a water-saturated atmosphere containing 5% CO2 at 37 °C.
To generate cells with reduced MAN1A1 expression, MDA-MB-231 cells were transfected with five expression vectors containing different shRNA sequences targeting human MAN1A1 and a scramble negative control (shRNA nc; Origene, Herford, Germany) using Lipofectamin (Invitrogen GIBCO/Life Technologies, Carlsbad, CA, USA) as previously described (Oliveira-Ferrer et al, 2014 (link)). After puromycin (1 μg ml−1, PAA Laboratories GmbH, Pasching, Austria) selection, the level of MAN1A1 protein and mRNA was determined with western blot analysis and RT–qPCR, and two cultures (MAN1A1 shRNA #2 and MAN1A1 shRNA #3) were chosen for further analysis.
To generate cells with reduced MAN1A1 expression, MDA-MB-231 cells were transfected with five expression vectors containing different shRNA sequences targeting human MAN1A1 and a scramble negative control (shRNA nc; Origene, Herford, Germany) using Lipofectamin (Invitrogen GIBCO/Life Technologies, Carlsbad, CA, USA) as previously described (Oliveira-Ferrer et al, 2014 (link)). After puromycin (1 μg ml−1, PAA Laboratories GmbH, Pasching, Austria) selection, the level of MAN1A1 protein and mRNA was determined with western blot analysis and RT–qPCR, and two cultures (MAN1A1 shRNA #2 and MAN1A1 shRNA #3) were chosen for further analysis.
7
Generating CRISPR-Cas9 YAP1 KO Clones
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Two guide oligos for YAP1 genomic knockout were generated using the protocol by Ran et al. and the online tool http://tools.genome-engineering.org . Sequences for guide oligo 1: upper CACCGCATCAGATCGTGCACGTCCG and lower AAACCGGACGTGCACGATCTGATGC and guide oligo 2 upper CACCGCAGCAGCCGCCGCCTCAAC and lower AAACGTTGAGGCGGCGGCTGCTGC. YAP1 guide oligos were cloned into pSpCas9(BB)-2A-Puro via Bbs1 sites. Expression of Cas9 was verified by western blotting through its Flag-Tag.
For the Crispr-Cas9 mediated YAP1 knockdown, HEK293T cells were transiently transfected with 4 µg YAP1-pSpCas9(BB)-2A-Puro plasmid. The transfected cells were further selected with Puromycin (PAA laboratories) in a final concentration of 1 µg/ml. After three weeks, individual clones were isolated and expanded. The clones with a reduced YAP1 expression (85% reduction) were transfected using PEI with GFP and GFP-RASSF1A for further characterization by qRT-PCR.
For the Crispr-Cas9 mediated YAP1 knockdown, HEK293T cells were transiently transfected with 4 µg YAP1-pSpCas9(BB)-2A-Puro plasmid. The transfected cells were further selected with Puromycin (PAA laboratories) in a final concentration of 1 µg/ml. After three weeks, individual clones were isolated and expanded. The clones with a reduced YAP1 expression (85% reduction) were transfected using PEI with GFP and GFP-RASSF1A for further characterization by qRT-PCR.
8
Drosophila and Cell Culture Maintenance
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Drosophila D.mel-2 (Invitrogen) and C3 cells were maintained in Express Five® SFM media (Invitrogen,) supplemented with 100 IU/mL penicillin, 100 μg/mL streptomycin, and 2 mM glutamine (Sigma-Aldrich) at 25°C in an cooled incubator. Expression of the reporter construct in C3 cells was maintained by the addition of 5μg/mL Blasticidin (PAA Laboratories). HeLa-M and C1 cells were grown in high glucose DMEM supplemented with 10% fetal calf serum, 100 IU/mL penicillin, 100 μg/mL streptomycin, and 2 mM glutamine (Sigma-Aldrich) at 37°C in a 5% CO2 humidified incubator. Expression of the reporter construct in C1 cells was maintained by the addition of 1.66μg/mL puromycin (PAA Laboratories). siRNA transfections were performed as in Gordon et al., 2010. The sequence of the siRNA used in the experiments can be found in (S2 Table ).
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!