Total RNA from the hypothalamus was extracted using TRIzol reagent (Takara Bio, Inc., Otsu, Japan), and was converted into complementary (c)DNA using a PrimeScript RT reagent kit (Takara Bio, Inc.). qPCR analysis was performed using SYBR-Green (Bio-Rad Laboratories, Inc., Hercules, CA, USA) in a real-time PCR apparatus (Applied Biosystems; Thermo Fischer Scientific, Inc., Waltham, MA, USA). The primers for RT-qPCR, whose sequences are shown in Table I , were designed and purchased from Takara Bio, Inc. A 20 µl total PCR reaction system was used, consisting of 10 µl 2x SYBR-Green Mixture (including GoldGtar Taq, DNA polymerase, PCR buffer, dNTPs, SYBR-Green; Takara Bio, Inc.), 1 µl forward and 1 µl reverse primer, 2 µl cDNA and 6 µl ddH2O. The reaction conditions were: 94°C denaturing for 5 min, followed by 40 cycles of 94°C for 15 sec and 60°C for 1 min. PCR was performed on an ABI GeneAmp 5700 real-time fluorescent quantitative PCR cycler (Applied Biosystems; Thermo Fisher Scientific, Inc.). The ΔΔCq method was used to determine the fold change for each group (27 (link)). GAPDH was used to normalize the expression of the target genes.
Real time pcr apparatus
Manufactured by Thermo Fisher Scientific
Sourced in United States
The real-time PCR apparatus is a laboratory instrument used for the amplification and detection of specific DNA sequences in real-time. It performs quantitative polymerase chain reaction (qPCR) analysis, allowing for the simultaneous amplification and quantification of target DNA or RNA molecules.
Automatically generated - may contain errors
Lab products found in correlation
Trizol reagent, by Takara Bio (2 mentions)
Sybr green, by Bio-Rad (1 mentions)
Sybr green mixture, by Takara Bio (1 mentions)
Primescript rt reagent kit, by Takara Bio (1 mentions)
Sybr green, by Takara Bio (1 mentions)
Hiscript 2 q rt supermix for qpcr gdna wiper, by Vazyme (1 mentions)
Sybr green, by Thermo Fisher Scientific (1 mentions)
Trizol reagent, by Thermo Fisher Scientific (1 mentions)
Cdna synthesis kit, by Thermo Fisher Scientific (1 mentions)
3 protocols using real time pcr apparatus
1
Quantitative PCR Analysis of Hypothalamic Gene Expression
2
qRT-PCR Analysis of Gene Expression
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA was extracted using Trizol reagent (TaKaRa, Japan) and ≈1000 ng RNA was reverse transcribed into complementary DNA (cDNA) using HiScript II Q RT SuperMix for qPCR (+gDNA wiper) (Vazyme, China). A real‐time PCR apparatus (Applied Biosystems, USA) was used to perform qRT‐PCR. Relative expression was calculated using the 2−ΔΔCT or 2−ΔCT method. PCR primers were designed as below, β‐actin forward, 5′‐ TCACCCACACTGTGCCCATCTACGA‐ 3′. β‐actin reverse, 5′‐ CAGCGGAACCGCTCATTGCCAATGG – 3′, IGF2BP2 forward, 5′‐CTACGCCTTCGTGGACTACC‐3′; IGF2BP2 reverse, 5′‐CATCCAACACCTCCCACTG‐3′; CDK6 forward, 5′‐CGTGGTCAGGTTGTTTGATG‐3′; CDK6 reverse, 5′‐CCTCGGAGAAGCTGAAACAT‐3′.
3
RNA Isolation and qRT-PCR Analysis
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA was isolated using Trizol reagent (Invitrogen, New York, NY, USA) and transformed into cDNA using a cDNA synthesis kit (Applied Biosystems, Foster City, CA, USA). Quantitative real-time (qRT)-PCR analysis was performed using SYBR Green with a real-time PCR apparatus (Applied Biosystems). Primers were synthesized and purchased by Integrated DNA Technologies (Coralville, IA, USA). Primer sequences are listed in Table 1 .
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!