Trizol reagent

Quantitative PCR assay was carried out based on the protocols reported previously [32 ]. Briefly, the total RNA was extracted from the intestine and brain tissues using TRizol reagent (KeyGen Biotech, Nanjing, China). The cDNA was generated using Perfect Real Time PrimeScript™ RT Master Mix. Real‐time quantitative PCR was conducted using TBGREEN Premix Ex Taq™ II (TliRNaseH Plus) on CFXConnect™ Real-Time System (Bio-Rad, Hercules, CA, USA). PCR reaction conditions were shown as follows: 95 °C for 2 min, followed by 40 amplification cycles of 95 °C for 5 s, 15 s at 60 °C and 20 s at 72 °C, then 65 °C and 95 °C for 5 s. All primers of target genes were synthesized by Sangon Biotech, Co., Ltd. (Shanghai, China, shown in Additional file 1: Table S1).

TRIzol reagent (Thermo Fisher Scientific), chloroform, isopropanol, and 75% ethanol were used to isolate total RNA from cell lines, and then A260/A280 values were measured to clarify the quality of the RNA. cDNA synthesis and quantitative PCR were performed as previously described.²⁰ GAPDH or U6 was used as an internal reference gene, and the relative expression levels of the genes were calculated by the 2−△△ct method. All primer sequences were as follows (5′‐3′): GAPDH (ACAACTTTGGTATCGTGGAAGG, GCCATCACGCCACAGTTTC); DICER1‐AS1 (CATGTGTTGTGAGGGTTCTTCTG, TCCAGACCACACATCCATATTCC); MAPK1 (GCACCAACCATCGAGCAAAT, CTTGAGGTCACGGTGCAGAA). U6, hsa‐miR‐3612 and hsa‐miR‐650 primers were provided by RiboBio.
To isolate nuclear and cytoplasmic RNA, we first isolated total RNA with TRIzol reagent and then used nuclear and cytoplasmic protein extraction kits (KeyGEN BioTECH). DICER1‐AS1 expression was measured by RT–qPCR.

Cultured organoids were dissolved by manual disruption and rinsed to remove matrix that could interfere with RNA harvest. RNA was harvested using Trizol reagent (KGA1201; KeyGEN BioTECH) formyl trichloride and isopropanol.³⁵ The high quality and concentration (≥10 nM) of RNA samples was confirmed using 2100 RNA Nano 6000 Assay Kit (Agilent Technologies, Santa Clara, CA, USA). Enriched mRNA was fragmented and subjected to reverse transcription. The amplified cDNA was sequenced using Illumina HiSeq2500 (Illumina, San Diego, CA, USA) with a read length of 100 bp. A heat map of DEGs (p ≤ 0.05 and |log2(FC)| > 1) was analyzed via hierarchical cluster method based on K‐means clustering. The y axis depicted the results of hierarchical clustering.

UII, LC3, and P62 mRNA expression in placentas was analyzed by real-time PCR method. Total RNA was extracted using Trizol reagent (KeyGEN BioTECH, Nanjing, China). For first-strand cDNA synthesis, 1 µg RNA was reverse transcribed in a 20 µl reaction using Fast Quant RT Kit (TIANGEN, Beijing, China). Then, cDNAs were subjected to quantitative real-time PCR analysis.
For the UII primer sense 5′-CGTCTATCTTGTGGCGATCA-3′,
anti-sense 5′-CCCAGCATCTCTGGCAGTAT-3′;
LC3 primer sense 5′-GATGTCCGACTTATTCGAGAGC-3′,
anti-sense 5′-TTGAGCTGTAAGCGCCTTCTA-3′;
P62 primer sense 5′-GCACACCAAGCTCGCATTC-3′,
anti-sense 5′-ACCCGAAGTGTCCGTGTTTC-3′;
For glyceraldehyde 3-phosphate dehydrogenase (GAPDH) control prime sense
5′-GCGAGATCCCTCCAAAATCAA-3′,
anti-sense was 5′- GTTCACACCCATGACGAACAT-3′.
Real-time PCR was performed using an Quant Studio 5 Real-Time PCR System (Thermo Fisher Scientific, Waltham, MA, USA) in a 20 µl reaction consisting of 0.3 µM each primer, 100 ng template cDNA, 10 µl SuperReal Premix Plus with SYBR Green I (TIANGEN, Beijing, China), and 0.4 µl ROX reference dye. The PCR was run at 95 °C for 15 min followed by 40 cycles of 95 °C for 10 s and 60 °C for 32 s. All samples were analyzed in duplicate. GAPDH was used as an internal control. mRNA expression was calculated using the comparative threshold cycle (2^−△△CT) method.