Moflo astrios eq sorter

Fresh-frozen brains were sliced using a cryostat at 150 μm thickness, and tissue around the injection site was punched out using a 1 mm tissue punch (Cat#57401, Stoelting, Illinois, USA). Nuclei were extracted using nuclear isolation protocol described in^{52 (link)}. GFP-KASH expressing nuclei were isolated using fluorescence activated cell sorting (FACS; MoFlo Astrios EQ sorter, Beckman-Coulter). Genomic DNA was then extracted and the parts of the DNA targeted by each guide were amplified using the following primer sequences for extracting DNA around the target of Nt guide 1 - forward AGCTCCTTCAGTGTCTGAGTG and reverse GGAGTTGTGAGATGCAGTTGAGC (product length 150) and Nt guide 2 – forward CATGATGACGACCTTGTTGGC and reverse TGGGTTCTGATACCTCCCAGT (product length 139). After second round PCR with barcoded primers, the extracted DNA was prepared for Illumina sequencing using the MiSeq Reagent Nano Kit, v2 (300 cycles) Cat: MS-103–1001MiSeq reagent kit (Cat# MS-102–2002, Illumina, San Diego, CA). Resulting data was analyzed using the website outknocker.org (v2 beta).

pX330-sgRNA_Dicer_1 plasmid (#68807, Addgene) was co-transfected with EX-NEG-M56 plasmid (GeneCopoeia) expressing mCherry into lung epithelial E10 cells using lipofectamine 3000. The transfected cells were then selected using Geneticin selective antibiotic (100 μg/ml) or mCherry-positive cell sorting (MoFlo™ Astrios EQ Sorter, Beckman). The successful transfection and deletion of dicer1 were verified using fluorescence microscopy, qPCR and western blotting with specific primers and an antibody against dircer1. The established cells were subjected to further experiments.

Hippocampi from 3 mice per experimental group were pooled for single nuclei RNA-seq. Dissected hippocampi were homogenized in lysis buffer (10% Triton X-100, 0.1M DTT, 40U/μL RNasin Promega, protease inhibitor complex, and 2% BSA in PBS) using a Dounce homogenizer for 10 strokes. Samples were incubated for 5 minutes on ice and then centrifuged at 500 × g for 5 minutes at 4μ°C in a tabletop centrifuge. The pellet was resuspended in sort buffer (0.5M EDTA, 40U/μL RNasin Promega, 2% BSA in PBS), transferred to FACS tube, filtered through a 70-μm mesh strainer, and centrifuged at 800 × g for 5 minutes at 4°C in a swinging bucket centrifuge. We resuspended the pellet in sort buffer and stained with the following antibodies: mouse anti-NeuN-Alexa Fluor 488 (1:500; MilliporeSigma; MAB377X [clone A60] and rat anti-SPI1 (PU.1) - PE (1:100; Biolegend 681308 [clone 7C2C34]) for neurons and microglia, respectively. DAPI (1:1,000; BioLegend 422801) was used to label nuclei. After immunolabeling, samples were strained through a 70-μm mesh strainer, washed 1 more time, resuspended in sort buffer, and kept on ice until FANS. PU.1+ nuclei were purified by FANS using a Beckman Coulter Mo-Flo Astrios EQ sorter. After selection of DAPI+ nuclei and exclusion of doublets, we gated on PU.1+ nuclei (Suppl.Fig.3).