Control vivo morpholino

Manufactured by Gene Tools

Control vivo-morpholino is a laboratory product designed for use in research applications. It serves as a control for experiments involving vivo-morpholinos, which are synthetic, modified oligonucleotides used to modulate gene expression in living organisms. The control vivo-morpholino provides a reference point for evaluating the effects of vivo-morpholinos in experimental settings.

Automatically generated - may contain errors

Lab products found in correlation

Vivo morpholino, by Gene Tools (2 mentions) Resazurin, by R&D Systems (1 mentions) Victor2 multilabel plate reader, by PerkinElmer (1 mentions)

2 protocols using control vivo morpholino

Intraocular Neurod Knockdown in Zebrafish

Cited 1 time

Check if the same lab product or an alternative is used in the 5 most similar protocols

Intraocular injections were performed in anaesthetised 5 dpf larvae with 0.4 nl/eye 0.5 mM neurod translation-blocking vivo-morpholino (5′-TGAC-TTCGTCATGTCGGAACTCTAG-3′) (Sarrazin et al., 2006 (link); Ochocinska and Hitchcock, 2009 (link)) or control vivo-morpholino (5′-CCTCTTACC-TCAGTTACAATTTATA-3′) (Gene Tools). Injections were performed 24-27 h before dissection of larval eyes.

Laranjeiro R, & Whitmore D. (2014). Transcription factors involved in retinogenesis are co-opted by the circadian clock following photoreceptor differentiation. Development (Cambridge, England), 141(13), 2644-2656.

+ Open protocol

+ Expand

Assessing Organoid Proliferation via Kras4B Knockdown

Check if the same lab product or an alternative is used in the 5 most similar protocols

Organoids were mechanically dissociated by vigorous pipetting. 20–100 fragments were seeded in 10 µl BME in a 24-well plate. 24 h after seeding, media was removed and replaced with fresh media containing either 5 μM Kras4B vivo-morpholino (Genetools - GTATAGAAGGCATCGTCAACACCCT) or 5 μM control vivo-morpholino (Genetools - CCTCTTACCTCAGTTACAATTTATA). Cell proliferation was assessed after 6 days later by adding 10% Resazurin (R&D systems, AR002). Fluorescence was measured using Victor2 Multilabel Plate Reader (PerkinElmer) as already described.

Hall A.E., Pohl S.Ö., Cammareri P., Aitken S., Younger N.T., Raponi M., Billard C.V., Carrancio A.B., Bastem A., Freile P., Haward F., Adams I.R., Caceres J.F., Preyzner P., von Kriegsheim A., Dunlop M.G., Din F.V, & Myant K.B. (2022). RNA splicing is a key mediator of tumour cell plasticity and a therapeutic vulnerability in colorectal cancer. Nature Communications, 13, 2791.

+ Open protocol

+ Expand

About PubCompare

Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.

We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.

However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.

Ready to get started?

Revolutionizing how scientists
search and build protocols!