Gibson assembly kit

Abdhfr was amplified from clarified cell lysates of four strains of A. baumannii using Phusion DNA polymerase (New England Biolabs, Ipswich, MA, USA) and primers 5′ctggtgccgcgcggcagccatATGGCATGGCAAAATGTAG3′ and 5′tcgggctttgttagcagccggatccTTATTTTTTATAAGTGGCAAATTCG3′ (lower case denoting sequence homologous to pET15b plasmid), and human DHFR from pL0035^{34 (link)} using primers 5′ctggtgccgcgcggcagccatATGGTTGGTTCGCTAAAC3′ and 5′tcgggctttgttagcagccggatccTTAATCATTCTTCTCATATACTTCAAATTTG3′. Amplicons were inserted into NdeI and BamHI digested pET15b plasmid using a Gibson Assembly kit (New England Biolabs). The thymidylate synthase gene (thyA, ts) was amplified from lysate of E. coli DH5α strain using Phusion DNA polymerase (New England Biolabs, Ipswich, MA, USA) and primers 5′ctagcggagctcggagtgaaacgATGAAACAGTATTTAGAACTGATGC3′ and 5′ gcctgcaggtcgactctagaTTAGATAGCCACCGGCGC3′ (lower case denoting sequence homologous to pBAD33 plasmid). Amplicon was inserted into SacI and XbaI sites of pBAD33 using the Gibson Assembly kit (New England Biolabs, Ipswich, MA, USA). Cloned plasmids were sequenced by 1^st Base DNA sequencing service (Singapore) and nucleotide sequences were deposited at GenBank, accession numbers: MH152688, MH152689, MH152690, and MH152691.

The primers used for plasmid construction are listed in Table S3. The primer pair F1/R1 was used to linearize the laboratory-stored plasmid pBBR1MCS-5. The fragments Cas9 and Cpf1 were PCR amplified using the primer pairs F2/R2 and F3/R3 with the templates of laboratory-stored SpyCas9 and FnCpf1 synthesized by Sangon Biotech Co., Ltd (Shanghai, China). The promoter P₁₁₄ was PCR amplified using the primer pair F4/R4, with the genomic DNA of G. oxydans WSH-003 as the template. The amplified P₁₁₄, Cas9/Cpf1, and linearized pBBR1MCS-5 were assembled using the Gibson assembly kit (NEB, Beijing, China), generating plasmids pBBR1MCS-5-P₁₁₄-Cas9/Cpf1. The primer pair F5/R5 was used to linearize the laboratory-stored plasmid p2-1. The fragment sgRNA scaffold was PCR amplified using the primer pair F6/R6 with the templates of laboratory-stored plasmid pTarget. The promoter leader was PCR amplified using the primer pair F7/R7, with the template of G. oxydans WSH-003. The amplified leader, sgRNA scaffold, and linearized p2-1 were assembled using the Gibson assembly kit (NEB, Beijing, China), generating plasmid p2-1-leader-sgRNA. The plasmid p2-1-leader-crRNA was cyclization PCR amplified using the primer pair F8/R8, with the template of plasmid p2-1-leader-sgRNA.

An ilys-2 homology repair template, pBADilys2, was designed to delete the first three exons of ilys-2. Two 1-kb homologous regions were PCR-amplified from C. elegans N2 genomic DNA (for primer sequences see Supplementary Table S7).
The Unc-119(+) rescue construct was amplified from punc-119cbr (Addgene #32568). The resulting DNA fragments were gel-purified and assembled into the pBAD cloning vector using the Gibson assembly kit (NEB).
The Hsp-70 homology repair template pBADhsp70 was designed to delete the common promoter region of F44E5.4 and F44E5.5. Using C. elegans N2 genomic DNA as a template, two homologous regions (1.81-kb and 1.877) were PCR-amplified (for primer sequences see Supplementary Table S6).
The Unc-119(+) rescue construct was amplified from punc-119cbr (Addgene #32568). The resulting DNA fragments were gel-purified and assembled into the pBAD cloning vector using the Gibson assembly kit (NEB).
sgRNA encoding vectors: pSgRilys2 and pSgRhsp70. sgRNA sequences were designed using the Benchling Genome Engineering software and cloned into pDD162 (Addgene #47549) with forward primer 5′-N₁₉GTTTTAGAGCTAGAAATAGCAAGT-3′ and reverse primer 5′-CAAGACATCTCGCAATAGG-3, where:
N19 pSgRilys2 = atataagccgtcaaggtag,
N19 pSgRhsp70 = gcatcaaatactgtattctc