Real-time PCR amplification was performed with the lightCycler fastStart DNA master SYBR green I (Roche, Hertfordshire, UK) at final concentrations of 3 mmol/l magnesium, 0.5 µmol/l of each primer, and 1X lightCycler fastStart DNA master SYBR green I. The final volume of each reaction was 20 µl, containing 50 ng of reverse transcription product as template. The amplification program started with 1 cycle at 95 °C for 10 minutes, followed by 38 cycles at 95 °C for 15 seconds, 60 °C for 20 seconds, and 72 °C for 20 seconds. The program ended with 1 cycle at 72 °C for 15 minutes. The following primers for lacZf and lacZr were designed to amplify 185 bp, and their sequences are as follows: lacZf: 5′-GCG TGG ATG AAG ACC AGC-3′, lacZr: 5′-CGA AGC CGC CCT GTA AAC-3′. The housekeeping 18s rRNA was used as an internal control;38 (link) 18srRNAf: 5′-TTG ACG GAA GGG CAC CAC CAG-3′, 18srRNAr: 5′-GCA CCA CCA CCC ACG GAA TCG-3′. For genomic PCR, all samples were normalized to 100 ng/ μl of gDNA. Hundred nanograms of DNA were used with similar PCR mixture contents and cycling parameters (40 cycles). LacZgf: 5′-GAC GTC TCG TTG CTG CAT AA-3′, LacZgr: 5′-CAG CAG CAG ACC ATT TTC AA-3′.
Lightcycler faststart dna master sybr green 1
Manufactured by Roche
Sourced in Germany, United States, Switzerland, United Kingdom
The LightCycler FastStart DNA Master SYBR Green I is a real-time PCR reagent kit. It contains all the necessary components for the quantitative detection of DNA sequences using the SYBR Green I detection format.
Automatically generated - may contain errors
Lab products found in correlation
Trizol reagent, by Thermo Fisher Scientific (24 mentions)
Rneasy mini kit, by Qiagen (19 mentions)
Lightcycler, by Roche (12 mentions)
Lightcycler 2, by Roche (12 mentions)
Tri reagent, by Merck Group (11 mentions)
Reverse transcription system, by Promega (9 mentions)
Transcriptor reverse transcriptase, by Roche (8 mentions)
M mlv reverse transcriptase, by Thermo Fisher Scientific (8 mentions)
Superscript 2 rt, by Thermo Fisher Scientific (7 mentions)
Lightcycler 480, by Roche (6 mentions)
Transcriptor first strand cdna synthesis kit, by Roche (6 mentions)
Tri reagent, by Molecular Research Center (6 mentions)
Rneasy plus mini kit, by Qiagen (6 mentions)
Lightcycler 1, by Roche (6 mentions)
Trizol, by Thermo Fisher Scientific (6 mentions)
Rnase free dnase set, by Qiagen (5 mentions)
Lightcycler relative quantification software version 3, by Roche (5 mentions)
Lightcycler 96, by Roche (5 mentions)
Lightcycler system, by Roche (5 mentions)
Human universal reference total rna, by Takara Bio (5 mentions)
186 protocols using lightcycler faststart dna master sybr green 1
1
Real-Time PCR Amplification of LacZ Gene
2
Kidney Cortex Total RNA Isolation and Gene Expression
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
For isolation of total RNA from kidney cortex, the NucleoSpin 8 RNA Kit (Macherey-Nagel, Düren, Germany) was used. Elimination of possible DNA contamination was performed with the RNase-Free DNase Set (Qiagen, Hilden, Germany), and 1 µg total RNA was reverse-transcripted into cDNA with the Reverse-Transcription System Promega (Promega, Madison, WI, USA). Determination of gene-expression levels was performed by semi-quantitative real-time PCR by use of the LightCycler-FastStart DNA Master SYBR Green 1 (Roche Diagnostics, Mannheim, Germany) and a thermocycler (qTower, Analytik Jena, Jena, Germany). PCRs were carried out with sense and antisense primers at a concentration of 0.25 µM each (purchased from TIB Molbiol, Berlin, Germany). Temperatures and sequences of all primer pairs are shown in Table 1 . Hypoxanthine phospho-ribosyltransferase 1 (HPRT1) was used as the housekeeping gene. Relative expression ratio was quantified by the ΔΔCT method, and transcript levels were normalized to the mean value of the MORG1 wild-type non-diabetic control group.
3
cDNA Synthesis and Real-time PCR
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
cDNA was synthesized from total RNA, and real-time PCR was performed using LightCycler-FastStart DNA Master SYBR Green 1 (Roche, Mannheim, Germany) with gene-specific primers (Supplementary Table S1). To control for variations in the reactions, PCR products were normalized against glyceraldehyde 3-phosphate dehydrogenase (GAPDH) expression.
4
Quantitative Real-Time PCR for Gene Expression Analysis
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total cellular RNA was purified from cultured cells using the RNeasy mini kit (Qiagen, Valencia, CA, USA) following the manufacturer's protocol. For quantitative real-time PCR (qRT–PCR), RNA was reverse-transcribed using the ReverTra Ace qPCR RT kit (TOYOBO, Osaka, Japan). The resulting cDNA was analysed by qRT–PCR using the LightCycler FastStart DNA Master SYBR Green 1 (Roche Diagnostics, GmbH, Mannheim, Germany). The cDNA products were amplified using primers specific for SIRT4 (forward: 5′-CAGCAAGTCCTCCTCTGGAC-3′ and reverse: 5′-CCAGCCTACGAAGTTTCTCG-3′) and CDH1 (forward: 5′-ACACCATCCTCAGCCAAGA-3′ and reverse: 5′-CGTAGGGAAACTCTCTCGGT-3′). ACTB primers (forward: 5′-GATGAGATTGGCATGGCTTT-3′ and reverse: 5′-CACCTTCACCGTTCCAGTTT-3′) were used as a normalisation control. All reactions were run on a LightCycler 2.0 Instrument (Roche Diagnostics) with a 10-min hot start at 95 °C followed by 45 cycles of a 3-step thermocycling programme: denaturation, 10 s at 95 °C; annealing, 10 s at 60 °C; and extension, 10 s at 72 °C.
5
Total RNA Extraction and Real-Time PCR Analysis
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA was isolated from kidney cortex homogenates (homogenizer SpeedMill P12 (Analytik Jena Bio Solutions, Jena, Germany)) using the RNeasy Lipid Tissue Mini Kit (Qiagen, Hilden, Germany), according to the manufacturer’s instruction. Possible DNA contaminations were eliminated using the RNase-Free DNase Set (Qiagen, Hilden, Germany). In total, 1 μg of total RNA was reverse transcribed into cDNA using the Reverse Transcription System (Promega, Madison, WI, USA). The determination of gene-expression levels was performed by semi-quantitative real-time PCR by use of the LightCycler-FastStart DNA Master SYBR Green 1 (Roche Diagnostics, Mannheim, Germany) and a thermocycler (qTower, Analytik Jena, Jena, Germany). RT-PCRs were carried out with sense and antisense primers at a concentration of 0.25 µM each (purchased from TIB Molbiol, Berlin, Germany). The program was completed after 35 cycles. The sequences and annealing temperatures of all primer pairs are listed in Table 1 . The relative expression ratio was quantified by the ΔΔCT method, values were normalized to the average of Hypoxanthine phospho-ribosyltransferase 1 (Hrpt1) and Glyceraldehyde-3-Phosphate Dehydrogenase (Gapdh), and the young male group was assigned as an arbitrary value of 1.
6
Quantifying Gene Expression in Mouse Kidney
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA from the kidney cortex was isolated using the NucleoSpin 8 RNA Kit (Macherey–Nagel, Düren, Germany). Possible DNA contamination was eliminated using the RNase-Free DNase Set (QIAGEN, Hilden, Germany), and 1 µg total RNA was reverse transcribed into cDNA with the Reverse Transcription System (Promega, Madison, WI, United States). Gene expression was assessed by semi-quantitative real-time PCR by LightCycler FastStart DNA Master SYBR Green 1 (Roche Diagnostics, Mannheim, Germany) using a thermocycler (qTOWER2, Analytik Jena, Germany). PCRs were carried out with sense and antisense primers at a concentration of 0.25 µM each (TIB MOLBIOL, Berlin, Germany). Temperatures and sequences of all primer pairs are shown in Table 1 . Hypoxanthine phosphoribosyltransferase 1 (HPRT1) was used as the housekeeping gene. The relative expression ratio was quantified by the ∆∆CT method, and the transcript levels were normalized to the mean value of the young male wild-type control group.
7
Quantitative Analysis of Dopaminergic Markers
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA was isolated using a ToTALLY RNA kit (Ambion, Austin, TX, USA). One microgram of the RNA template was reverse-transcribed using a Transcript First Strand cDNA Synthesis kit (Roche Diagnostics, Basel, Switzerland) according to the manufacturer's guidance. Subsequently, a 2 µL aliquot of each sample was subjected to real-time polymerase chain reaction (PCR) in a 20 µL reaction mixture containing 4 mM MgCl2, 10 pmol of upstream and downstream primers, and 2 µL of 10X Light Cycler Fast Start DNA Master SYBR Green 1 (Roche Diagnostics). Data were analyzed with Light Cycler software version 3.5 (Roche Diagnostics). The following primer sets were chosen for real-time PCR analyses.
Glyceraldehyde 3-phosphate dehydrogenase: 5'-GTGTTCCTACCCCCAATGTG-3'; 5'-TGTGAGGGAGATG-CTCAGTG-3' (400 bp), Nurr1: 5'-CGGTTTCAGAAGTGCCTAGC-3'; 5'-CTGGGTTGGACCTGTATGCT-3' (420 bp), Pitx3: 5'-ACAAAGTGGAAC-CCCTATGAG-3'; 5'-TTCTTGGCCAATCTGTAGGA-3' (255 bp), tyrosine hydroxylase (TH): 5'-TTGGCTGACCGCACATTTG-3'; 5'-ACGAGAGGC-ATAGTTCCTGAGC-3' (336 bp), aromatic L-amino acid decarboxylase (AADC): 5'-AGAAGAGGCAAGGAGATGGTGG-3'; 5'-AAGCGAAGAAAT-AGGGAC-TCTGC-3' (214 bp), dopamine receptor 2 (D2R): 5'-CCTT-CATCGTCACCCTGCTGG-3'; 5'-CTCCATTTCCAGCTCCTGAG-3' (245 bp/158 bp).
Glyceraldehyde 3-phosphate dehydrogenase: 5'-GTGTTCCTACCCCCAATGTG-3'; 5'-TGTGAGGGAGATG-CTCAGTG-3' (400 bp), Nurr1: 5'-CGGTTTCAGAAGTGCCTAGC-3'; 5'-CTGGGTTGGACCTGTATGCT-3' (420 bp), Pitx3: 5'-ACAAAGTGGAAC-CCCTATGAG-3'; 5'-TTCTTGGCCAATCTGTAGGA-3' (255 bp), tyrosine hydroxylase (TH): 5'-TTGGCTGACCGCACATTTG-3'; 5'-ACGAGAGGC-ATAGTTCCTGAGC-3' (336 bp), aromatic L-amino acid decarboxylase (AADC): 5'-AGAAGAGGCAAGGAGATGGTGG-3'; 5'-AAGCGAAGAAAT-AGGGAC-TCTGC-3' (214 bp), dopamine receptor 2 (D2R): 5'-CCTT-CATCGTCACCCTGCTGG-3'; 5'-CTCCATTTCCAGCTCCTGAG-3' (245 bp/158 bp).
8
Quantifying Heat Shock Protein Levels in Medaka Fish
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA was extracted from chemical-treated and untreated medaka fry. Two micrograms of DNase-treated total RNA was used for synthesizing first strand cDNA using an oligo-dT primer and SuperScript TM II Reverse Transcriptase according to the manufacturer's protocol (Invitrogen). The cDNA samples were used for qPCR analysis using Lightcycler-FastStart DNA Master SYBR Green 1 and Lightcycler480 (Roche Applied Science) according to the manufacturer's instruction. Both hsp70 and β-actin (internal control) mRNAs were measured and -ΔΔCt was used to represent the relative expression level of the genes. The statistical comparison of the relative mean expression level for hsp70 gene between test and control groups was performed using Student's T test with P value <0.05 being considered significant. The primer pair for hsp70 gene was: forward, 5′ CACAAAGTCATCCAGCAA AC; reverse 5′ TCAGTCCACCTCCTCAATAG. The pair for β-actin was: forward, 5′CCGTGACATCAAGGATAAGCT; reverse 5′ TCGTGGATACCGCAAGATTCC.
9
Quantifying GABA A and D3R Expression in Alcohol-Exposed NAc
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
NAc was freshly dissected out for real-time quantitative RT-PCR by using punches (bilateral) of 14-gauge on ice, held in ice-cold PBS solution and frozen on dry ice according to Koo et al. [18] . Total RNA was isolated by TRIzol (Invitrogen, Carlsbad, CA) from the brain tissues. Single-stranded cDNA was synthesized with Super-Script III (Invitrogen), by random priming. Aliquots of cDNA were amplified in parallel reactions with external standards at known amounts, using specific primer pairs for α6-GABA A subunit, D 3 R and GAPDH (reference gene). GAPDH levels did not differ among different groups and were not changed by alcohol exposure in the DID paradigm. Each PCR reaction (20 μl final volume), contained 0.5 mM primers, 1.6 mM Mg 2+ , and 1 X Light Cycler-Fast Start DNA Master SYBR Green I (Roche Diagnostics, IN). Amplifications were carried out in a Light Cycler 1.5 instrument (Roche Diagnostics). Quantification was obtained by the ΔCt comparative method.
10
Transcriptional Response of D. gigas to GSNO
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
D. gigas WT and ΔhcpR1 mutant strain were grown until mid-exponential phase (OD600 ≈ 0.4) and were either untreated or exposed to 10 μM of GSNO for 1 h. Culture sampling was performed inside an anaerobic chamber (855-AC, Plas-Labs). Total RNA extraction was carried out as previously described [12,41] . RNA samples were treated with DNase (TURBOTM DNase-free; Ambion) according to the manufacturer’s instructions and purified by on-column DNAse I digestion (RNase-Free DNase Set; Qiagen). Total RNA (1 μg) was reverse transcribed with Transcriptor Reverse Transcriptase (Roche Diagnostics). qRT-PCR reactions were performed in the LightCycler 480 Real-Time PCR System (Roche), using Light Cycler Fast Start DNA Master SYBR Green I (Roche). Relative standard curves were constructed for each gene, using triplicate serial dilutions of cDNA. The relative expression of the genes was calculated by the relative quantification method with efficiency correction, using the LightCycler 480 software 1.5. 16S RNA gene was used as a reference gene. The primers used in this assay are listed in Supplementary data, Table S2 . qRT-PCR experiments were carried out using biological triplicates.
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!