Quantstudio real time pcr software version 1

DNA was isolated from mouse fecal pellets by using the Qiagen DNeasy PowerSoil Kit (Qiagen), according to the manufacturer’s instructions. DNA was eluted in 35 μL of provided elution buffer. Densities were measured using a 16S qPCR^{64 (link)}. Amplification and detection by real-time PCR were performed with the QuantStudio 6 Flex Real-Time PCR System (Thermo Fisher). Duplicate samples were used for determination of DNA by real-time PCR. All samples were analyzed in duplicate in a 10 μL reaction volume using the TaqMan Universal PCR Master Mix (Applied Biosystems), containing 300 nM of each of the universal forward and reverse primers and 200 nM of the fluorogenic probe. The reaction conditions for amplification of DNA were 95 °C for 10 min, and 45 cycles of 95 °C for 15 s and 60 °C for 1 min.
Data analysis was done with the QuantStudio Real-Time PCR Software version 1.3 (Applied Biosystems). Cycle threshold (Ct) values were reported as a representative estimation of bacterial load^{64 (link)}. Lower limit of detection was determined as Ct from negative DNA extraction protocol control Primer and probe sequences are listed in Supplementary Table 2.

Splenic cell suspensions were prepared as described above. 1×10⁵ cells were cultured in Iscove's modified Dulbecco's medium supplemented with 10% fetal calf serum (Gibco), 2 mM l‐glutamine, 100 U/mL penicillin/streptomycin (Lonza) and 50 µM β‐mercaptoethanol (Sigma‐Aldrich) for 3 days. Cells were cultured in U‐bottom 96‐well plates and left untreated or treated with 50 ng/mL recombinant IL‐23 (R&D Systems). RNA was isolated using the GenElute Mammalian Total RNA Miniprep Kit according to manufacturer's instructions (Sigma Aldrich). RNA was treated with 0.1 U/µL DNAse I Amplification Grade (Invitrogen). cDNA was synthesized using random hexamer primers and 10 U/µL Superscript II (Invitrogen). Primers were designed with ProbeFinder software (Roche Applied Sciences, USA) and probes were used from the Universal Probe Library (Roche Applied Science, USA). 18srRNA (forward primer 5′‐GCAATTATTCCCCATGAACG‐3′; reverse primer 5′‐ GGGACTTAATCAACGCAAGC‐3′; probe 48) was used to normalize gene expression. For CCR7, forward primer 5′‐ CAGGGAAACCCAGGAAAAAC‐3′ and reverse primer 5′‐ATCTTGGCAGAAGCACACCT‐3′ with probe 77 were used. Real‐time PCR was performed using the Viia7 system and data were analyzed using QuantStudio Real‐time PCR software version 1.3 (Applied Biosystems, USA).

RNA was isolated from the (co)cultured cell lysates with the GenElute Mammalian Total RNA Miniprep Kit (Sigma-Aldrich), treated with 0.1 U/μl DNAse (Invitrogen) and reverse transcribed into cDNA using 10 U/μl Superscript II (Invitrogen) and random hexamer primers. The PCR was performed using TaqMan Universal Mastermix (Thermofisher Waltham, Massachusetts, USA). Primers and probes were designed and chosen using ProbeFinder Software and the Universal Probe library (Roche Applied Science, Indianapolis, IN, USA) and are listed in Additional file 3. The qPCR reaction per gene included 10 ng μl of cDNA, 1x l TaqMan Universal Mastermix, 10 pmol forward primer, 10 pmol reverse primer, and 0.012 μM probe. The RT-PCR was performed with the Viia7 System (Applied Biosystems, Waltham, MA, USA), with an initial cycle at 50 °C for 2 min and a heating cycle at 95 °C for 10 min, followed by 45 cycles of 30 s at 95 °C and 30 s at 60 °C. Hypoxanthine phosphoribosyltransferase (HPRT) was used to normalize transcript levels. RT-PCR was performed with the Viia7 System and analyzed using QuantStudio Real-Time PCR Software version 1.3 (Applied Biosystems).