Impromii kit

Total RNA was extracted from soleus skeletal muscle tissue (40–50 mg) using QIAzol lysis reagent (Qiagen). Total RNA (2 μg) was reverse transcribed into cDNA using the IMPROM II kit (Promega). The quantitative polymerase chain reaction amplifications were quantified using a Light Cycler 480 SYBR Green I Master (Roche). The genes analyzed were INSR, IRS-1, PI3K-CA, GLUT-4, PPAR-α, and PPAR-γ, with GAPDH as a reference gene. The primers used are shown in Table 3.

Total RNA was obtained from frozen samples using the TRIzol® Reagent (Invitrogen) according to the manufacturer’s instructions. cDNA was synthesized from each sample (2 μg of total RNA) with an ImProm II Kit (Promega). qPCR was performed with the Stratagene MX3000P® equipment. The expression levels of GRXC9 and PR-1 were calculated relative to the YLS8 (AT5G08290) or Clathrin adaptor complex subunit (AT4G24550) genes. Primers used for each gene are listed in Online Resource 8.

100 to 200 ng of RNA were used for cDNA synthesis using Improm II kit (Promega) according to the manufacturer’s protocol. 50 µl of RNAse free water were added to the cDNA mixture to a final volume of 80 µl. sqRTPCR was performed using 1 μl of a diluted cDNA mixture, primers as listed in Table S5 and a Readymix polymerase (Lambda biotech) according to manufacturer’s instructions. Gels were recorded using a DNR MiniBIsPro BioImager with the DNR Gel Capture software with no further processing (DNR Bio-Imaging Systems, Israel).

Total RNA was extracted with TRIzol according to the manufactureŕs instructions and quantified using Qubit reagent (Invitrogen). RNA was treated with DNase I (Ambion, Austin TX, USA) to remove potential contamination and reverse transcribed using random primers and the ImProm-II kit (Promega) to synthesize double-stranded cDNA. qPCR was performed with the commercial reagent Maxima SYBR Green qPCR Master Mix (Promega, Madison WI, USA) to determine GREM1, cyclophilin and GAPDH mRNA expression levels using the following primers: human GREM1 F (5′-CCCGGGGAGGAGGTGCTGGAGT-3′); human GREM1 R (5′-CCGGATGTGCCTGGGGATGTAGAA-3′); mouse cyclophilin1 F (5′-GCAGACATGGTCAACCCCACCG-3′); mouse cyclophilin1 R (5′-GAAATTAGAGTTGTCCACAGTCGG-3′); mouse GAPDH F(5′-TCCGCCCCTTCTGCCGATG-3′); and mouse GAPDH R (5′-CACGGAAGGCCATGGCAGTGA-3′). PCR product specificity was verified by melting curve analysis, and all of the real-time PCR reactions were performed in triplicate. The 2^−ΔΔCT method was used to analyze the relative changes in gene expression levels [21] (link).

RNA from whole hippocampus was isolated and reverse transcribed as previously described [23 (link)]. Briefly, brains were dissected, and samples were homogenized in Trizol according to manufacturer's instructions. RNA was precipitated and treated with one unit of DNase I (Life Technologies). Five micrograms of total RNA were reverse transcribed using random primers and ImProm II kit (Promega). cDNA was quantified by qPCR using Kapa SYBR Quantimix (Kapa). The qPCR analysis was performed in triplicates from one reverse transcribed product using the Rotor-Gene 6000 (Corbett). Values were analyzed following the 2^−ΔΔCt method using cyclophilin-A (Cyc) and β2-microglobulin (B2m) as normalization controls using the following primer pairs: Ryr3 F:TGGTGTCGGTGATGATCTGT and R:TGCACAGGTTGTCCATTGAT [4 (link), 20 (link)]; Cyc F:GGCAATGCTGGACCAAACACAA and R:GTAAAATGCCCGCAAGTCAAAAG; B2m F:GCTATCCAGAAAACCCCTCAA and R:CATGTCTCGATCCCAGTAGACGGT [23 (link), 24 (link)].

Total RNA of whole seedlings was obtained from frozen samples using the TRIzol® Reagent (Invitrogen, #15596026). cDNA was synthesized with the ImProm II Kit (Promega). qPCR was performed using the Brilliant III Ultra-Fast SYBR® Green QPCR Master mix reagents (Agilent Technologies, #600882) on an AriaMx real-time PCR system. The expression levels of GRXC9 (AT1G28480), GSTU7 (AT2G29420), GSTU8 (AT3G09270), and GSTU22 (AT1G78340) were calculated relative to the YLS8 (AT5G08290) housekeeping gene. The expression of YLS8 and other described housekeeping genes was analyzed from RNAseq data (Supplementary Fig. S1). Primers used for each gene are listed in Supplementary Table S3.