Tryptic soy agar plate
Tryptic soy agar plates are a type of microbiology growth media used for the cultivation of a variety of microorganisms, including bacteria and fungi. They provide a nutrient-rich environment that supports the growth of a wide range of microbial species.
Lab products found in correlation
31 protocols using tryptic soy agar plate
Microbial Enumeration of Beef Patties
Hemolytic Activity Screening of Hybrid Strains
Bacterial Enumeration in Meat Samples
Endocarditis Streptococcus gordonii Isolation
Human colon cancer cells lines HCT116 and HT29 were cultured in Dulbecco’s Modified Eagle’s Medium supplemented with 10% fetal bovine serum (FBS) (GIBCO, USA).
Staphylococci Characterization and Identification
Pathogen Identification in Waterfowl
Evaluating Fusobacterium nucleatum Growth
Virus detection in goose homogenates
Primers used for virus detection.
Primer name | Sequence (5ʹ-3ʹ) | Target | Reference |
---|---|---|---|
GPV-F | AGACTTATCAACAACCATCAT(C) T | VP1 gene of GPV (779 bp) | (Todd et al., 2009 (link)) |
GPV-R | TCACTTATTCCTGCTGTAG | ||
GHPV-F | GAGGTTGTTGGAGTGACCACAATG | VP1 gene of GHPV (144 bp) | (Guerin et al., 2000 (link)) |
GHPV-R | ACAACCCTGCAATTCCAAGGGTTC | ||
REOV-F | GGTGCGACTGCTGTATTTGGTAAC | S1 gene of REOV (513 bp) | (Niu et al., 2017 (link)) |
REOV-R | AATGGAACGATAGCGTGTGGG | ||
TMUV-F | GCCACGGAATTAGCGGTTGT | E gene of TMUV (401 bp) | (Su et al., 2011 (link)) |
TMUV-R | TAATCCTCCATCTCAGCGGTGTAG | ||
FAdV-F | CAACTACATCGGGTTCAGGGATAACTTC | Hexon gene of FAdV (766 bp) | (Ye et al., 2016 (link)) |
FAdV-R | CCAGTTTCTGTGGTGGTTGAAGGGGTT | ||
GAstV-F | CGGTGGAATACATCAGCGAGTA | RdRP gene of GAstV (390 bp) | (Yuan et al., 2019 (link)) |
GAstV-R | CCTTCCTTATTGACACAAGCCTAT |
Evaluating Fusobacterium nucleatum Growth
Gram Stain Procedure for Bacterial Identification
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!