Control shrna lentiviral particles

MTP18-shRNA and control-shRNA lentiviral particles were purchase from Santa Cruz Biotechnology, Inc. (Dallas, TX, USA). MTP18-shRNA contains a pool of concentrated, transduction ready viral particles containing 3 target-specific constructs, encoding shRNA designed to knockdown MTP18 expression and control shRNA lentiviral particles contains an shRNA construct encoding a scramble sequence that will not lead to specific degradation of any know cellular mRNA. The MTP18 shRNA: sc-75842-VA hairpin sequence was 5′-GATCCCTCCTCCTGATCATACTCTTTCAAGAGAAGAGTATGATCAGGAGGAGTTTTT; sc-75842-VB hairpin sequence was GATCCGACAGAAGCTTAGAGACAATTCAA GAGAT TGTCTCTAAGCTTCTGT TTTTT; and sc-75842-VC hairpin sequence was GATCCCAAGGAATAGGCC CAAGATTTCAAGAG AATCTTGGGCCTATTCCTTG TTTTT. The scramble MTP18 shRNA sense seq-uence was 5′-GCACTACCAGAG CTAACTCAGATAGTACT-3′, and the antisense sequence was 5′-AGTACTATCTGAG TTAGCTCTGGTAGTGC-3′. Cells were infected with the virus according to manufactural protocol. The stable transfected clones were selected in a culture medium containing 2.5 μg/mL puromycin (Life Technologies, Grand Island, NY, USA) for 4 weeks. The stable transfected cells were seeded into 96-well plate by limited dilution in order to obtain single cell colony. Several single cell colonies were cultured and the MTP18 expression levels were checked by western blot.

PKCζ shRNA lentiviral particles, control shRNA lentiviral particles, and copGFP control lentiviral particles, were purchased from Santa Cruz Biotechnology (Texas, USA). Following the manufacturers instruction, the target cells were seeded in a 12-well plate for 24 h before the transfection, and became approximately 50% confluent on the day of infection. After the media was replaced by the transfection media with Polybrene (Santa Cruz) at a concentration of 5 μg/ml, the shRNA lentiviral particles were added into the cells. The transfection media was removed after 24 h, and then the cells were cultured in complete media for 48 h. To select the stable clones expressing the shRNA, the infected cells were cultured in the media with Puromycin at 5 μg/ml for 2 weeks, and then several colonies were picked up and expanded for validation of knock down of endogenous PKCζ.

Stable depletion of LC3 was carried out by infection of neurons with shRNA-expressing lentiviral particles (Santa Cruz, CA, USA) and selection with puromycin (5 μg/ml). Positive clones were screened by western blotting. The neurons were allowed to proliferate for 1 week before any experimental procedures. Control shRNA lentiviral particles (Santa Cruz, CA, USA) were used for comparison.

STAU1-shRNA lentiviral particles (sc-76586-V) and control shRNA lentiviral particles were purchased from Santa Cruz (CA, USA) and infected SH-SY-5Y cells. Cells were maintained in 2% DMEM medium at 37 °C with 5% CO₂ for 48 h, after which they were replaced with fresh medium containing 1 μg/mL puromycin. Cells were trypsin digested, passaged, and supplemented with puromycin-containing medium every 2–3 days. After all the cells in the negative control without lentivirus were dead and the cells infected with lentivirus were grown, a portion of the cells were washed once with PBS, and the supernatant was discarded as much as possible. A measure of 200 μL of RIPA lysis solution (strong) was added, the cells were lysed on ice for 30 min, and then the supernatant was collected by centrifugation at 12,000 × g rpm for 5 min for Western blot. The cell lines were tested for STAU1 expression. After the cell lines were successfully constructed, the cells were frozen in liquid nitrogen for seed preservation. Afterwards, STAU1 knockdown cell lines were infected with RABV and the effect of STAU1 downregulation on RABV replication was verified using Western blot, TCID₅₀, and RT-qPCR.

Antibodies used in this study include the following: GRP78 antibody (N-20 and C-20, Santa Cruz Biotechnology, Santa Cruz, CA, USA), Phosphos-IRE1α (Ser724) antibody (Abcam, Cambridge, UK); E-cadherin (Stressgen, Victoria, Canada); STAT3, Phospho-STAT3 (Tyr705), JAK2, Phospho-JAK2 (Tyr1007/1008), CHOP, Caspase-3, IRE1α, and PARP antibody (Cell Signaling Technology, Beverley, MD, USA); and β-tubulin antibody (Sigma-Aldrich, Steinheim, Germany). Tunicamycin was from Sigma-Aldrich. Dulbecco’s Modified Eagles Medium (DMEM), fetal bovine serum (FBS), and Geneticin (G418) were purchased from HyClone (Logan, UT, USA). STAT3 specific inhibitor benzoic acid (2-Hydroxy-4-(((4-methylphenyl)sulfonyloxy)acetyl)amino)-benzoic acid, NSC74859), human STAT3/shRNA, and control shRNA lentiviral particles were obtained from Santa Cruz Biotechnology.

LNCaP^RANKL cells were grown in 6-well plates to 60% confluence, then transfected with 100 pmol final concentration of AP-4 siRNA or control siRNA (Santa Cruz Biotechnology, Inc.) for 48 hrs, using Lipofectamine 2000 (Invitrogen, Carlsbad, CA). Samples were collected for qRT-PCR and western blot analysis or further transfected with AR or PSA promoter for the luciferase promoter assay as described above.
For cell transduction, LNCaP^RANKL cells were grown in 48-well plates to 50% confluence 24 hrs before transduction. Next day, the complete medium was replaced with complete medium containing Polybrene at a 5 μg/ml final concentration. Cells were infected with AP-4 or control sh-RNA lentiviral particles (Santa Cruz) for 24 hrs. Cells were cultured for an extra 24 hrs before being split to 1:3 ratio. Cell selection was started after an additional 24 hrs with 2 μg/ml of Puromycin.