Pcr thermal cycler dice touch
The PCR Thermal Cycler Dice Touch is a compact and versatile laboratory instrument designed for polymerase chain reaction (PCR) amplification of DNA samples. It features a high-resolution touchscreen interface for intuitive programming and control of the thermal cycling process.
Lab products found in correlation
10 protocols using pcr thermal cycler dice touch
Quantitative RT-PCR Analysis
Semi-quantitative PCR of Satellite DNA Genes
Characterization of HBV cccDNA and HBx in PXB cells
Quantitative Analysis of REST/sREST Isoforms
Maxillary Tissue Gene Expression Analysis
Genotyping of DMD Variant in Affected Cats
22 (link) Polymerase chain reaction was performed using the forward primer 5′‐GGGAGACACAGAATCGGAAACAG‐3′ and reverse primer 5′‐AAGTCTCAGCGTTCTGCATGTG‐3′. The PCR was performed as follows in a PCR Thermal Cycler Dice Touch (Takara, Japan): 1 cycle of 94°C for 2 minutes, 98°C for 10 seconds, 60°C for 15 seconds, and 68°C for 45 seconds, followed by 35 cycles with an additional 5‐minute incubation at 68°C. The resultant PCR products were purified using MultiScreen (Merck, Darmstadt, Germany). We used an additional primer for Sanger sequencing (forward: 5′‐TCACTCTGTGCAAGGCACTAG‐3′). Sanger sequencing was performed using BigDye Terminator v.3.1 (Applied Biosystems, Foster City, CA) and analyzed on an ABI 3730xl DNA analyzer (Applied Biosystems).
Genetic Analysis of Dog Breeds
RT-PCR Analysis of TIPARP and GAPDH
RNA Extraction and Gene Expression Analysis
Canine Genomic DNA Isolation and Polymorphism Analysis
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!