Pei reagent

Manufactured by Polysciences

Sourced in United States

PEI reagent is a cationic polymer that is commonly used as a transfection agent for the delivery of nucleic acids, such as plasmid DNA, mRNA, and siRNA, into mammalian cells. It functions by forming complexes with the nucleic acids, which can then be taken up by the cells.

Automatically generated - may contain errors

Lab products found in correlation

Spelling variants of this product

PEI transfection reagent (78 citations) PEI MAX reagent (31 citations) Polyethylenimine (PEI) transfection reagent (4 citations) PEI 25K linear transfection reagent (2 citations) PEI MAX polyethylenimine reagent (2 citations) PEI, MW 25,000) transfection reagent (2 citations) Linear PolyEthylenImine reagent (PEI) (2 citations) Linear Polyethylenimine (PEI, MW 25,000) transfection reagent (2 citations) PEI-MAX 4000 transfection reagent (2 citations)

56 protocols using pei reagent

Cell Culture and Transfection Protocols

Check if the same lab product or an alternative is used in the 5 most similar protocols

MCF-7, T47D, SK-BR-3, MDA-MB-231, SUM-159, 4T1, and HEK-293T cells were maintained in Dulbecco’s modified Eagle’s medium (DMEM) supplemented with 10% (v/v) fetal bovine serum and penicillin (50 U/ml)/streptomycin (50 µg/ml) at 37 °C under 5% CO₂ in a humidified chamber. MCF-10A cells were maintained in DMEM/F12 supplemented with 5% horse serum, EGF (20 ng/ml), insulin (10 µg/ml), hydrocortisone (0.5 µg/ml), cholera toxin (100 ng/ml), penicillin (50 U/ml), and streptomycin (50 µg/ml) at 37 °C under 5% CO₂ in a humidified chamber. All cell lines were obtained from American Type Culture Collection (ATCC) (https://www.atcc.org/) and tested negative for mycoplasma contamination.
Transient transfections were carried out using PEI reagent (23966-2, Polysciences) according to the manufacturer’s instructions. For lentiviral infection, viruses were packaged into HEK-293T cells, and injected into MCF-10A, MDA-MB-231, SUM-159, and 4T1 cells.

Zou X., Ma L., Zhang Y., Zhang Q., Xu C., Zhang D., Chu Y., Zhang J., Li M., Zhang H., Wang J., Peng C., Wei G., Wu Y., Hou Z, & Jia H. (2023). GATA zinc finger protein p66β promotes breast cancer cell migration by acting as a co-activator of Snail. Cell Death & Disease, 14(6), 382.

+ Open protocol

+ Expand

Transcriptional Regulation of BCCIP Gene

Cited 1 time

Check if the same lab product or an alternative is used in the 5 most similar protocols

BCCIP promoter region (926 bp, −724 ~+202 bp; 391 bp, −330 ~+61 bp; 272 bp, −277 ~ −5 bp) was introduced into pGL4-Luc vector. Similar to previously described (Wu et al. 2013 (link)), 293T cells grown on 12-well plates were co-transfected with 0.4 μg of pGL4 which encodes firefly luciferase, 0.12 ng of the control plasmid Renilla luciferase vector which encodes renilla luciferase and effector plasmid expressing pGL4-BCCIP using PEI reagent (Polysciences, U.S.A.). Total effector plasmids in each transfection were adjusted to 0.8 μg with empty vector. 48 h after transfection, the transactivation activity of pGL4-BCCIP was determined by measuring firefly and Renilla luciferase activities using the Dual-Luciferase Reporter assay kit (Promega, U.S.A.).

Su J., Sui Y., Ding J., Li F., Shen S., Yang Y., Lu Z., Wang F., Cao L., Liu X., Jin J, & Cai Y. (2016). Human INO80/YY1 chromatin remodeling complex transcriptionally regulates the BRCA2- and CDKN1A-interacting protein (BCCIP) in cells. Protein & Cell, 7(10), 749-760.

+ Open protocol

+ Expand

Transient HEK293T Cell Transfection

Cited 1 time

Check if the same lab product or an alternative is used in the 5 most similar protocols

HEK293T cells were cultured in Dulbecco’s modified Eagle’s medium GlutaMAX (Invitrogen, Life Technologies, Grand Island, NY) containing 10% fetal bovine serum. Transfection was performed using PEI reagent (Polysciences, PA) as described [14 (link)].

Cho I.T., Lim Y., Golden J.A, & Cho G. (2017). Aristaless Related Homeobox (ARX) Interacts with β-Catenin, BCL9, and P300 to Regulate Canonical Wnt Signaling. PLoS ONE, 12(1), e0170282.

+ Open protocol

+ Expand

Transfection of neuroblastoma and hippocampal cell lines

Check if the same lab product or an alternative is used in the 5 most similar protocols

SH-SY5Y human neuroblastoma cell line (ATCC CRL-2266) and mHypoA-2/12 cell line (CLU177) are typically maintained in the high glucose DMEM (Gibco, 1129855) supplemented with 10% Fetal Bovine Serum (Life Technologies, 10500–064) in the presence of penicillin, streptomycin, L-Glutamine and amphotericin B (10378016, Gibco). SH-SY5Y, mHpoA-2/12 and mHippoE-14 cells were transfected with either pCDNA3 and pCDNA3-mPea3, pCDNA3-Erm or pCDNA3-Er81 (courtesy of Prof. A.D. Sharrocks) using the PEI reagent (Polysciences), in 3 replicas per sample.

Kandemir B., Gulfidan G., Arga K.Y., Yilmaz B, & Kurnaz I.A. (2020). Transcriptomic profile of Pea3 family members reveal regulatory codes for axon outgrowth and neuronal connection specificity. Scientific Reports, 10, 18162.

+ Open protocol

+ Expand

Transfection Protocols for HEK293T and Astrocytes

Cited 1 time

Check if the same lab product or an alternative is used in the 5 most similar protocols

Standard transfection protocols were performed in HEK293T cells (Cai et al., 2019 (link)) and astrocytes. Briefly, 24 h before transfection, HEK293T cells were split equally into plates of the desired size. Astrocytes at passage 2 were prepared and grown in 35 mm dishes for GABA uptake and 100 mm dishes for western blot. The experiments were conducted in cells with 80–90% confluence. Transfection for both HEK293T cells and astrocytes was based on our standard PEI protocol with PEI reagent (40 kD, Polysciences) at a DNA: transfection reagent ratio of 1:2.5, and the cells were harvested 48 h after transfection. For radiolabeling GABA uptake, 1 μg of the cDNAs with PEI at a ratio of 1:2.5 μl was transfected in each 35 mm dish. For total protein expression, 3 μg cDNAs were used for transfection in each 60 mm dish, while 10 μg cDNAs were used for transfection in each 100 mm dish. The cDNAs were combined with Dulbecco Modified Eagle Medium (DMEM) and a PEI/DMEM mixture. For iPSC derived human astrocytes, both PEI and lipofectamine 2000 transfection protocols were used. Lipofectamine transfection was conducted per the manufacturer’s protocol. The experiments were conducted 48 h after transfection.

Mermer F., Poliquin S., Zhou S., Wang X., Ding Y., Yin F., Shen W., Wang J., Rigsby K., Xu D., Mack T., Nwosu G., Flamm C., Stein M, & Kang J.Q. (2022). Astrocytic GABA transporter 1 deficit in novel SLC6A1 variants mediated epilepsy: Connected from protein destabilization to seizures in mice and humans. Neurobiology of disease, 172, 105810.

+ Open protocol

+ Expand

Dual Luciferase Assay for NFκB Activation

Cited 1 time

Check if the same lab product or an alternative is used in the 5 most similar protocols

Dual luciferase reporter assays were performed as previously described21 (link)24 (link). Keratinocytes were seeded at 3 × 10⁵ cells/mL in 24 well dishes the day prior to transfection. Cells were transfected with NFκB-driven firefly luciferase reporter, Renilla luciferase (RLTK) expressing plasmid as transfection control, and each of the plasmids encoding HPV proteins using the PEI reagent (PolySciences). At 24 hours post transfection cells were stimulated with the appropriate reagents for 6–24 hours (see figure legends for details – all ligands purchased from Invivogen) prior to lysis in passive lysis buffer (Promega). Firefly luciferase levels were normalised to Renilla levels and fold induction values were calculated relative to the normalised activity of the mock.

Richards K.H., Wasson C.W., Watherston O., Doble R., Eric Blair G., Wittmann M, & Macdonald A. (2015). The human papillomavirus (HPV) E7 protein antagonises an Imiquimod-induced inflammatory pathway in primary human keratinocytes. Scientific Reports, 5, 12922.

+ Open protocol

+ Expand

p53-Dependent Transcriptional Activity Assay

Cited 1 time

Check if the same lab product or an alternative is used in the 5 most similar protocols

Pp53-TA-Luc plasmid (D2223, Beyotime) including multiple p53 response elements (ACGTTTGCCTTGCCTGGACTTGCCTGGCCTTGCCTTGGACATGCCCGGGCTGTC) was obtained from Beyotime Biotechnology (Shanghai, China). HCT116 cells were co-transfected with Pp53-TA-Luc (0.4 μg), which encodes firefly luciferase, the control plasmid renilla luciferase vector (0.12 ng), which encodes renilla luciferase, and the plasmids expressing YY1 and BCCIP using PEI reagent (Polysciences, Beijing, China). Total effector plasmid (1.7 μg) in each transfection was adjusted with empty vectors. pp53-TA-Luc transactivity was estimated 48 h later by measuring firefly and renilla luciferase activities using the Dual-Luciferase reporter assay kit (Promega, Madison, WI, USA) and by normalizing firefly to Renilla luciferase [18 (link)].

Sui Y., Wu T., Li F., Wang F., Cai Y, & Jin J. (2019). YY1/BCCIP Coordinately Regulates P53-Responsive Element (p53RE)-Mediated Transactivation of p21Waf1/Cip1. International Journal of Molecular Sciences, 20(9), 2095.

+ Open protocol

+ Expand

Co-expression and Immunoprecipitation of NARS2

Cited 2 times

Check if the same lab product or an alternative is used in the 5 most similar protocols

GFP- and HA-tagged NARS2 constructs were co-expressed in HEK293T cells, after transfection using PEI reagent (Polysciences). Forty-eight hours after transfection, cells were harvested and homogenized with sonication in lysis buffer (50mM Tris HCl pH7.4, 100mM NaCl, 1% NP-40, 2mM Na3VO4) containing a protease inhibitor mixture (#P8340, Sigma). Immunoprecipitation was performed with an anti-GFP antibody as described previously [65 (link)]. The cell lysates and the immunoprecipitates were processed for Western blot analysis [66 (link)]. NARS2 (Abcam), GAPDH (Ambion), GFP (Life Technologies) and HA antibody (Millipore) were used for immunoprecipitation and Western blot analyses.

Simon M., Richard E.M., Wang X., Shahzad M., Huang V.H., Qaiser T.A., Potluri P., Mahl S.E., Davila A., Nazli S., Hancock S., Yu M., Gargus J., Chang R., Al-sheqaih N., Newman W.G., Abdenur J., Starr A., Hegde R., Dorn T., Busch A., Park E., Wu J., Schwenzer H., Flierl A., Florentz C., Sissler M., Khan S.N., Li R., Guan M.X., Friedman T.B., Wu D.K., Procaccio V., Riazuddin S., Wallace D.C., Ahmed Z.M., Huang T, & Riazuddin S. (2015). Mutations of Human NARS2, Encoding the Mitochondrial Asparaginyl-tRNA Synthetase, Cause Nonsyndromic Deafness and Leigh Syndrome. PLoS Genetics, 11(3), e1005097.

+ Open protocol

+ Expand

COS-7 Cell Transfection with PEI

Check if the same lab product or an alternative is used in the 5 most similar protocols

African green monkey kidney fibroblasts (COS-7) cells (Gluzman, 1981 (link)) were grown in Dulbecco’s modified Eagle’s medium supplemented with 10% (vol/vol) fetal bovine serum (FBS). Cells were transfected with the cDNA constructs using PEI reagent (Polysciences, Inc) according to the manufacturer’s instructions. The empty vector pSG5 was used to transfect control cells.

Ritter M.L., Avila J., García-Escudero V., Hernández F, & Pérez M. (2018). Frontotemporal Dementia-Associated N279K Tau Mutation Localizes at the Nuclear Compartment. Frontiers in Cellular Neuroscience, 12, 202.

+ Open protocol

+ Expand

Comparative Cell Culture and Transfection Assay

Check if the same lab product or an alternative is used in the 5 most similar protocols

Human embryonic kidney HEK293, mouse neuroblastoma N2A and human neuroblastoma SH-SY5Y cell lines were cultured in Dulbecco’s modified Eagle’s medium (DMEM) containing 10% fetal bovine serum (FBS), 1 mM sodium pyruvate, 2 mM L-glutamine, 50 units/ml penicillin G sodium, and 50 μg/ml streptomycin sulfate (Invitrogen). All cells were maintained in a humidified 37°C incubator containing 5% CO₂. 500 ng plasmid DNA per well of 24-well-plate for luciferase assay or 2 μg plasmid DNA per 35-mm-diameter plate for RNA extraction and Western blot analysis were used for cell transfection, respectively. For luciferase assay, pCMV-Rluc (Promega, USA) was co-transfected as a control to normalize the transfection efficiency. The cells were transfected using PEI reagent (Cat^#. 23966, Polysciences Inc.) or Lipofectamine-™ 2000 reagent (Invitrogen). Cells were harvested 24 hrs after transfection and lysed with 100 μl 1× passive lysis buffer (Promega) per well. Firefly luciferase activities and Renilla luciferase activities of the same sample were sequentially assayed on a luminometer (Turner Designs Model 20/20) following the protocol of the Dual-luciferase Reporter Assay System (Promega). The firefly luciferase activity was normalized to the Renilla luciferase activity and the resulted value reflected the promoter activity.

Duan X., Tong J., Xu Q., Wu Y., Cai F., Li T, & Song W. (2014). Upregulation of human PINK1 gene expression by NFκB signalling. Molecular Brain, 7, 57.

+ Open protocol

+ Expand

About PubCompare

Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.

We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.

However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.

Ready to get started?

Revolutionizing how scientists
search and build protocols!