Total RNA was isolated using a total RNA extraction reagent (ABclonal). RNA was reverse-transcribed to complementary DNA (cDNA) with ABScript III Reverse Transcriptase (ABclonal). Quantitative real-time reverse transcription polymerase chain reaction (RT-PCR) was performed using Genious 2X SYBR Green Fast qPCR Mix (ABclonal). The 20 μL reaction mixture contained 400 nM primers, 10 μL of SYBR Green Fast qPCR Mix, 2 μL of template cDNA, and nuclease-free water. cDNA amplification was conducted via Archimed X6 quantitative real-time PCR (RocGene) following the manufacturer’s instructions. Glyceraldehyde-3-phosphate dehydrogenase (GAPDH) was used as an internal control.
Genious 2x sybr green fast qpcr mix
Manufactured by ABclonal
Sourced in China
Genious 2X SYBR Green Fast qPCR Mix is a ready-to-use solution for real-time quantitative PCR (qPCR) applications. It contains SYBR Green I dye and all the necessary components for efficient and fast qPCR amplification.
Automatically generated - may contain errors
Lab products found in correlation
Nanodrop nd 1000 spectrophotometer, by Thermo Fisher Scientific (3 mentions)
Primescript rt master mix, by Takara Bio (2 mentions)
Abscript 2 rt master mix, by ABclonal (2 mentions)
Abscript 3 rt master mix, by ABclonal (2 mentions)
Reverse transcription kit, by ABclonal (2 mentions)
Trizol, by Thermo Fisher Scientific (2 mentions)
Nanodrop 2000, by Thermo Fisher Scientific (2 mentions)
Abscript 3 reverse transcriptase, by ABclonal (1 mentions)
Quantstudio 7, by Thermo Fisher Scientific (1 mentions)
Rnaiso plus, by Takara Bio (1 mentions)
Lightcycler 480 sequence detector system, by Roche (1 mentions)
Animal total rna isolation kit, by Foregene (1 mentions)
Quantstudio 6 flex, by Thermo Fisher Scientific (1 mentions)
Trizol reagent, by Thermo Fisher Scientific (1 mentions)
Trizol reagent, by Tsingke (1 mentions)
Transscript one step gdna removal and cdna synthesis supermix, by Transgene (1 mentions)
Rneasy column, by Qiagen (1 mentions)
Cfx connect, by Bio-Rad (1 mentions)
Reveraid first strand cdna synthesis kit, by Thermo Fisher Scientific (1 mentions)
Rna easy fast tissue cell kit, by Tiangen Biotech (1 mentions)
14 protocols using genious 2x sybr green fast qpcr mix
1
Total RNA Extraction and RT-qPCR Analysis
2
Quantitative RT-PCR Analysis of Gene Expression
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA was extracted with RNAiso Plus (Takara) and reverse transcribed into cDNA with PrimeScriptRT Master Mix (Takara). cDNA was then subsequently used for quantitative RT-PCR by Genious 2X SYBR Green Fast qPCR Mix (Abclonal) on a QuantStudio 7 (Applied Biosystems) system according to the manufacturer’s instruction. The comparative ΔΔCt (cycle threshold) method that can calculate the changes in relative gene expression levels was used to analyze qRT-PCR data. Primers used in qRT-PCR are provided in the Supplementary Table 2 .
3
Quantitative PCR analysis of immune gene expression
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Trizol was used to isolate the total RNA, and the concentration and purity of isolated RNA were measured by NanoDrop 2000 (ThermoFisher, Shanghai, China). Complementary DNA (cDNA) was reverse transcribed from total RNA samples using a ABScript II RT Master Mix kit (ABclonal, China). qRT-PCR samples were prepared using a commercial kit (Genious 2X SYBR Green Fast qPCR Mix, ABclonal, China) and determined by a lightCycler 480 Sequence Detector System (Roche, Switzerland). All kits were used according to the manufacturer's instructions. The primers used in the study are shown in Table 1 .Table 1
The sequence of primers used in this study.
| Gene | Primer | Base sequence (5′ to 3′) |
|---|---|---|
| hTNF-α | Forward | CTGGGCAGGTCTACTTTGGG |
| hIL-6 | Forward | GTCCAGTTGCCTTCTCCCTGG |
| hIL-17 | Forward | TCTGTGATCTGGGAGGCAAAG |
| hIL-22 | Forward | GGGAGAAACTGTTCCACGGAG |
| hSTAT3 | Forward | CTGTCAGATGCCAAATGC |
| hGAPDH | Forward | CCATGGGGAAGGTGAAGGTC |
4
Hepatic Fibrosis Induction and Analysis
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
PHI (MUST-20060710, purity ≥98%) was purchased from Must Bio-Technology Co., Ltd. (Chengdu, China). Carbon tetrachloride (P1491992) was obtained from Titan Scientific Co., Ltd. (Shanghai, China). Olive oil (2019102901) and Sodium carboxymethyl cellulose (2018022601) were collected from Chron Chemicals Co., Ltd. (Chengdu, China). 4% paraformaldehyde (CR2011054) was purchased from Servicebio Technology Co., Ltd. (Wuhan, China). Animal total RNA isolation kit (R201101) was obtained from Foregene Co., Ltd. (Chengdu, China). ABScript II RT Master Mix (9620041118) and Genious 2X SYBR Green Fast qPCR Mix (9620041114) were purchased from ABclonal Technology Co., Ltd. (Wuhan, China).
5
qRT-PCR Profiling of Target Genes
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
500ng RNA was reverse transcribed into cDNA for each sample using the PrimeScript™RT Master Mix (Takara, RR036A). The cDNAs were amplified using Genious 2X SYBR Green Fast qPCR Mix (ABclonal, RK21206) with a Real-time PCR instrument (QuantStudio 6 Flex, ThermoFisher, USA) following the manufacturer’s instructions. The β-actin gene was chosen as an internal reference, and the expressions of target genes were calculated using the comparative CT method (2−ΔΔCT). The sequences of primers used are shown in Table S2
6
Quantifying Gene Expression by qPCR
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA was extracted with TRIzol reagent (Invitrogen). Reverse transcription was performed with the ABScript III RT Master Mix for quantitative polymerase chain reaction (qPCR) (ABclonal, RK20428). Real‐time qPCR was performed with the Genious 2X SYBR Green Fast qPCR Mix (ABclonal, RK21, 204). The relative target gene expression quantity was estimated by using the ΔCt method. The primers used in this research were listed in Table 1 .
7
Quantitative RT-PCR for Gene Expression
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA was extracted from liver samples with TRIzol reagent (Tsingke, China, TSP401). The concentration and quality of the RNA were measured with a NanoDropND-1000 Spectrophotometer (Thermo Fisher Scientific, Madison, WI, USA). Then 1 μg of total RNA was treated with ABScript III RT Master Mix (ABclonal, Wuhan, China, RK20429) according to the manufacturer’s instructions. Quantitative Real-time PCR was performed using 1 μL first-strand cDNA with the Genious 2X® SYBR Green Fast qPCR Mix (ABclonal, China, RK21206) in a final volume of 10 μL. All samples were run in triplicate and underwent 45 amplification cycles in an Mx3000P (Stratagene, Santa Clara, CA, USA). Peptidylprolyl isomerase A (PPIA), which is not affected by the experimental factors, was chosen as the reference gene. All the primers listed in Table 2 were synthesized by Tsingke Company (Nanjing, China). The method of 2−ΔCT t was used to analyze the real-time PCR results, and gene mRNA levels were expressed as the fold change compared to the mean value of the control group.
8
Quantifying NCOA3 mRNA Expression
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Here, qRT-PCR was conducted on a RT PCR detection system (CFX Connect, Bio-Rad, Hercules, CA). We used Genious 2X SYBR Green Fast qPCR Mix (Catalog No. RM21203, ABclonal) for qRT-PCR. Total RNA was extracted from one million cells by RNeasy columns (Catalog No. 74104, QIAGEN). We used 2 µg of RNA to perform reverse transcription with random primers using TransScript One-Step gDNA Removal and cDNA Synthesis SuperMix (Catalog No. AT311-02, TransGen Biotech, Beijing, China). The qRT-PCR was then performed using primers (forward, 5′-GGACCTGGTTAACACAAGTG-3′; reverse, 5′-GTCCAGGAAACTCCATTAACTG-3′) for NCOA3 messenger RNA (mRNA).
9
Quantitative RT-PCR Analysis of Gene Expression
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
For extraction of total RNA, the RNA Easy Fast Tissue/Cell kit (DP451, TIANGEN) was utilized. Subsequently, cDNA synthesis was performed using the ReverAid First Strand cDNA Synthesis Kit (K1622, Thermo Scientific). The synthesized cDNA was combined with Genious 2X SYBR Green Fast qPCR Mix (RK21206, Abclonal Technology) and specific primers (Supplementary Table S1 ). The ABI 7300 QuantStudio3 PCR (RT-PCR) System was employed to quantify the mRNA levels of the target genes.
10
Quantitative Real-Time PCR Analysis
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNAs were extracted using RNA Trizol Reagent (15,596,026, ThermoFisher). RNAs were reversed into cDNAs using the ABScript II cDNA First-Strand Synthesis Kit (RK20400, ABclonal). Then, Genious 2X SYBR Green Fast qPCR Mix (RK21204, ABclonal) was used for quantitive real-time PCR. The primers were listed as followed: NKE8 forward: 5-CTTCGTGCAGATCCTGCTTG-3, Reverse: 5-GGAGATGCCGAAATCACCGAT-3; c-MYC forward: 5-GGCTCCTGGCAAAAGGTCA-3, Reverse: 5- CTGCGTAGTTGTGCTGATGT-3.
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!